Incidental Mutation 'R5553:Hspbap1'
ID435237
Institutional Source Beutler Lab
Gene Symbol Hspbap1
Ensembl Gene ENSMUSG00000022849
Gene NameHspb associated protein 1
Synonyms3830421G21Rik
MMRRC Submission 043110-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R5553 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location35770375-35828477 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 35801597 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 104 (W104L)
Ref Sequence ENSEMBL: ENSMUSP00000156217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023555] [ENSMUST00000231579]
Predicted Effect probably damaging
Transcript: ENSMUST00000023555
AA Change: W104L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023555
Gene: ENSMUSG00000022849
AA Change: W104L

DomainStartEndE-ValueType
JmjC 126 288 1.29e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180485
Predicted Effect probably damaging
Transcript: ENSMUST00000231579
AA Change: W104L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231802
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to one of the small heat shock proteins, specifically hsp27. Hsp27 is involved with cell growth and differentiation. This encoded protein was found to be abnormally expressed in patients with intractable epilepsy, although how brain function is affected remains unknown. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,920,841 I86F probably damaging Het
Abca13 C T 11: 9,328,158 L3113F probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Ano8 T A 8: 71,484,997 probably null Het
Arid1b A T 17: 5,313,877 S1041C probably damaging Het
Bsn T A 9: 108,110,421 probably benign Het
Cbr3 A G 16: 93,683,563 E80G possibly damaging Het
Chd1 A G 17: 17,385,613 E271G probably benign Het
Dock3 T A 9: 106,991,110 K658N possibly damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dppa1 T A 11: 46,613,034 probably null Het
Fam129a C T 1: 151,717,235 T557M probably damaging Het
Fen1 T C 19: 10,200,423 N219S probably benign Het
Fsip2 A G 2: 82,962,746 T416A probably benign Het
Gm14393 A T 2: 175,061,846 C89* probably null Het
Grin2c C T 11: 115,252,725 M736I probably null Het
Heatr5b A T 17: 78,753,351 probably null Het
Igfn1 C T 1: 135,967,884 G1648E probably damaging Het
Irf4 A G 13: 30,751,828 Y122C probably damaging Het
Kremen2 A G 17: 23,741,802 probably benign Het
Nubpl T A 12: 52,181,299 L169M possibly damaging Het
Nwd1 T C 8: 72,704,976 S1200P possibly damaging Het
Olfr352 A G 2: 36,870,465 I300V probably benign Het
Olfr485 A T 7: 108,159,271 S201T probably benign Het
Parp14 G T 16: 35,856,936 H887Q probably benign Het
Paxip1 G A 5: 27,775,639 probably benign Het
Piwil1 T C 5: 128,745,501 M392T probably benign Het
Plekhm3 T C 1: 64,921,886 S404G possibly damaging Het
Prelid3a T C 18: 67,477,023 L141P probably damaging Het
Ptprb T A 10: 116,350,185 V1715E probably damaging Het
Rc3h2 G A 2: 37,398,311 R420* probably null Het
Selenon C A 4: 134,540,917 R435L probably damaging Het
Slc29a4 T C 5: 142,720,036 L425P probably damaging Het
Slc30a9 T A 5: 67,345,604 probably null Het
Slc9a5 T C 8: 105,357,040 V404A probably damaging Het
Ssc5d A T 7: 4,936,290 D575V probably damaging Het
Ttn A C 2: 76,891,596 probably null Het
Vmn2r100 A G 17: 19,504,848 Q13R possibly damaging Het
Wfikkn1 T A 17: 25,878,494 L285F possibly damaging Het
Zcchc17 A G 4: 130,354,134 probably null Het
Other mutations in Hspbap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Hspbap1 APN 16 35814061 splice site probably benign
IGL01377:Hspbap1 APN 16 35825311 missense possibly damaging 0.48
IGL03070:Hspbap1 APN 16 35818726 missense probably damaging 0.96
R1099:Hspbap1 UTSW 16 35824944 missense probably damaging 0.99
R1346:Hspbap1 UTSW 16 35801665 missense probably damaging 1.00
R1532:Hspbap1 UTSW 16 35825303 missense probably damaging 1.00
R1848:Hspbap1 UTSW 16 35818764 critical splice donor site probably null
R1867:Hspbap1 UTSW 16 35801564 missense possibly damaging 0.77
R4512:Hspbap1 UTSW 16 35787241 missense probably damaging 0.98
R4718:Hspbap1 UTSW 16 35787322 missense probably benign 0.07
R5590:Hspbap1 UTSW 16 35801663 missense probably damaging 1.00
R6151:Hspbap1 UTSW 16 35817222 missense probably damaging 1.00
R6612:Hspbap1 UTSW 16 35801591 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTTAACCTTAAGAACACATCCG -3'
(R):5'- AACCTGTCAGGGCTCACATG -3'

Sequencing Primer
(F):5'- ACACATCCGTTCTTTTGGTTTTATTG -3'
(R):5'- GTCAGGGCTCACATGAGTACTTAC -3'
Posted On2016-10-24