Incidental Mutation 'R5553:Cbr3'
ID435239
Institutional Source Beutler Lab
Gene Symbol Cbr3
Ensembl Gene ENSMUSG00000022947
Gene Namecarbonyl reductase 3
Synonyms1110001J05Rik
MMRRC Submission 043110-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R5553 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location93683215-93690990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93683563 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 80 (E80G)
Ref Sequence ENSEMBL: ENSMUSP00000156328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039620] [ENSMUST00000231302]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039620
AA Change: E80G

PolyPhen 2 Score 0.576 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047712
Gene: ENSMUSG00000022947
AA Change: E80G

DomainStartEndE-ValueType
Pfam:adh_short 6 151 4e-29 PFAM
Pfam:KR 7 102 9.1e-10 PFAM
Pfam:adh_short 183 243 4.3e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000231302
AA Change: E80G

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonyl reductase 3 catalyzes the reduction of a large number of biologically and pharmacologically active carbonyl compounds to their corresponding alcohols. The enzyme is classified as a monomeric NADPH-dependent oxidoreductase. CBR3 contains three exons spanning 11.2 kilobases and is closely linked to another carbonyl reductase gene - CBR1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,920,841 I86F probably damaging Het
Abca13 C T 11: 9,328,158 L3113F probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Ano8 T A 8: 71,484,997 probably null Het
Arid1b A T 17: 5,313,877 S1041C probably damaging Het
Bsn T A 9: 108,110,421 probably benign Het
Chd1 A G 17: 17,385,613 E271G probably benign Het
Dock3 T A 9: 106,991,110 K658N possibly damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dppa1 T A 11: 46,613,034 probably null Het
Fam129a C T 1: 151,717,235 T557M probably damaging Het
Fen1 T C 19: 10,200,423 N219S probably benign Het
Fsip2 A G 2: 82,962,746 T416A probably benign Het
Gm14393 A T 2: 175,061,846 C89* probably null Het
Grin2c C T 11: 115,252,725 M736I probably null Het
Heatr5b A T 17: 78,753,351 probably null Het
Hspbap1 G T 16: 35,801,597 W104L probably damaging Het
Igfn1 C T 1: 135,967,884 G1648E probably damaging Het
Irf4 A G 13: 30,751,828 Y122C probably damaging Het
Kremen2 A G 17: 23,741,802 probably benign Het
Nubpl T A 12: 52,181,299 L169M possibly damaging Het
Nwd1 T C 8: 72,704,976 S1200P possibly damaging Het
Olfr352 A G 2: 36,870,465 I300V probably benign Het
Olfr485 A T 7: 108,159,271 S201T probably benign Het
Parp14 G T 16: 35,856,936 H887Q probably benign Het
Paxip1 G A 5: 27,775,639 probably benign Het
Piwil1 T C 5: 128,745,501 M392T probably benign Het
Plekhm3 T C 1: 64,921,886 S404G possibly damaging Het
Prelid3a T C 18: 67,477,023 L141P probably damaging Het
Ptprb T A 10: 116,350,185 V1715E probably damaging Het
Rc3h2 G A 2: 37,398,311 R420* probably null Het
Selenon C A 4: 134,540,917 R435L probably damaging Het
Slc29a4 T C 5: 142,720,036 L425P probably damaging Het
Slc30a9 T A 5: 67,345,604 probably null Het
Slc9a5 T C 8: 105,357,040 V404A probably damaging Het
Ssc5d A T 7: 4,936,290 D575V probably damaging Het
Ttn A C 2: 76,891,596 probably null Het
Vmn2r100 A G 17: 19,504,848 Q13R possibly damaging Het
Wfikkn1 T A 17: 25,878,494 L285F possibly damaging Het
Zcchc17 A G 4: 130,354,134 probably null Het
Other mutations in Cbr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Cbr3 APN 16 93683443 missense probably benign 0.00
IGL02861:Cbr3 APN 16 93685119 missense probably damaging 0.96
R1764:Cbr3 UTSW 16 93690482 missense probably damaging 0.98
R5154:Cbr3 UTSW 16 93685139 missense probably benign 0.37
R5888:Cbr3 UTSW 16 93690726 missense probably damaging 1.00
R6644:Cbr3 UTSW 16 93690511 missense probably damaging 1.00
R6880:Cbr3 UTSW 16 93690538 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TGACCTGTGTCGGAAATTCTC -3'
(R):5'- TGAAAGTTCCAAGGAGGGCC -3'

Sequencing Primer
(F):5'- AAATTCTCCGGGGACGTGGTGC -3'
(R):5'- ACCCGAGTCACCGCACG -3'
Posted On2016-10-24