Mutagenetix > Incidental Mutation

Incidental Mutation 'R5553:Chd1'

435241

Institutional Source

Beutler Lab

Gene Symbol

Chd1

Ensembl Gene

ENSMUSG00000023852

Gene Name

chromodomain helicase DNA binding protein 1

Synonyms

4930525N21Rik

MMRRC Submission

043110-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5553 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

15925229-15992872 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 17605875 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 271 (E271G)

Ref Sequence

ENSEMBL: ENSMUSP00000156350 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024620] [ENSMUST00000232199] [ENSMUST00000232396]

AlphaFold

P40201

Predicted Effect

probably benign
Transcript: ENSMUST00000024620
AA Change: E271G

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000024620
Gene: ENSMUSG00000116564
AA Change: E271G

Domain	Start	End	E-Value	Type
Pfam:Rio2_N	9	91	9.5e-36	PFAM
Pfam:Kdo	105	193	6.3e-8	PFAM
Pfam:RIO1	108	284	1.7e-57	PFAM
Pfam:APH	194	278	3.2e-8	PFAM
low complexity region	326	340	N/A	INTRINSIC
low complexity region	501	518	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181390

Predicted Effect

probably benign
Transcript: ENSMUST00000232199
AA Change: E113G

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

probably benign
Transcript: ENSMUST00000232396
AA Change: E271G

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	T	A	15: 60,792,690 (GRCm39)	I86F	probably damaging	Het
Abca13	C	T	11: 9,278,158 (GRCm39)	L3113F	probably damaging	Het
Ankrd39	C	T	1: 36,581,062 (GRCm39)	G96R	probably damaging	Het
Ano8	T	A	8: 71,937,641 (GRCm39)		probably null	Het
Arid1b	A	T	17: 5,364,152 (GRCm39)	S1041C	probably damaging	Het
Bsn	T	A	9: 107,987,620 (GRCm39)		probably benign	Het
Cbr3	A	G	16: 93,480,451 (GRCm39)	E80G	possibly damaging	Het
Dock3	T	A	9: 106,868,309 (GRCm39)	K658N	possibly damaging	Het
Dot1l	CCAGCCCCACCCTCAGCC	CCAGCC	10: 80,619,462 (GRCm39)		probably benign	Het
Dppa1	T	A	11: 46,503,861 (GRCm39)		probably null	Het
Fen1	T	C	19: 10,177,787 (GRCm39)	N219S	probably benign	Het
Fsip2	A	G	2: 82,793,090 (GRCm39)	T416A	probably benign	Het
Gm14393	A	T	2: 174,903,639 (GRCm39)	C89*	probably null	Het
Grin2c	C	T	11: 115,143,551 (GRCm39)	M736I	probably null	Het
Heatr5b	A	T	17: 79,060,780 (GRCm39)		probably null	Het
Hspbap1	G	T	16: 35,621,967 (GRCm39)	W104L	probably damaging	Het
Igfn1	C	T	1: 135,895,622 (GRCm39)	G1648E	probably damaging	Het
Irf4	A	G	13: 30,935,811 (GRCm39)	Y122C	probably damaging	Het
Kremen2	A	G	17: 23,960,776 (GRCm39)		probably benign	Het
Niban1	C	T	1: 151,592,986 (GRCm39)	T557M	probably damaging	Het
Nubpl	T	A	12: 52,228,082 (GRCm39)	L169M	possibly damaging	Het
Nwd1	T	C	8: 73,431,604 (GRCm39)	S1200P	possibly damaging	Het
Or1j20	A	G	2: 36,760,477 (GRCm39)	I300V	probably benign	Het
Or5p61	A	T	7: 107,758,478 (GRCm39)	S201T	probably benign	Het
Parp14	G	T	16: 35,677,306 (GRCm39)	H887Q	probably benign	Het
Paxip1	G	A	5: 27,980,637 (GRCm39)		probably benign	Het
Piwil1	T	C	5: 128,822,565 (GRCm39)	M392T	probably benign	Het
Plekhm3	T	C	1: 64,961,045 (GRCm39)	S404G	possibly damaging	Het
Prelid3a	T	C	18: 67,610,093 (GRCm39)	L141P	probably damaging	Het
Ptprb	T	A	10: 116,186,090 (GRCm39)	V1715E	probably damaging	Het
Rc3h2	G	A	2: 37,288,323 (GRCm39)	R420*	probably null	Het
Selenon	C	A	4: 134,268,228 (GRCm39)	R435L	probably damaging	Het
Slc29a4	T	C	5: 142,705,791 (GRCm39)	L425P	probably damaging	Het
Slc30a9	T	A	5: 67,502,947 (GRCm39)		probably null	Het
Slc9a5	T	C	8: 106,083,672 (GRCm39)	V404A	probably damaging	Het
Ssc5d	A	T	7: 4,939,289 (GRCm39)	D575V	probably damaging	Het
Ttn	A	C	2: 76,721,940 (GRCm39)		probably null	Het
Vmn2r100	A	G	17: 19,725,110 (GRCm39)	Q13R	possibly damaging	Het
Wfikkn1	T	A	17: 26,097,468 (GRCm39)	L285F	possibly damaging	Het
Zcchc17	A	G	4: 130,247,927 (GRCm39)		probably null	Het

Other mutations in Chd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00704:Chd1	APN	17	15,952,827 (GRCm39)	missense	probably benign	0.37
IGL01356:Chd1	APN	17	15,970,127 (GRCm39)	missense	probably damaging	1.00
IGL01369:Chd1	APN	17	15,975,259 (GRCm39)	missense	probably damaging	0.97
IGL01519:Chd1	APN	17	17,598,831 (GRCm39)	missense	probably damaging	1.00
IGL01604:Chd1	APN	17	15,990,359 (GRCm39)	missense	possibly damaging	0.95
IGL01635:Chd1	APN	17	17,598,858 (GRCm39)	missense	probably damaging	1.00
IGL01721:Chd1	APN	17	15,990,430 (GRCm39)	missense	probably damaging	1.00
IGL01959:Chd1	APN	17	15,962,435 (GRCm39)	missense	probably damaging	1.00
IGL02367:Chd1	APN	17	17,610,315 (GRCm39)	missense	probably damaging	0.98
IGL02476:Chd1	APN	17	15,954,535 (GRCm39)	missense	probably damaging	1.00
IGL02756:Chd1	APN	17	15,951,069 (GRCm39)	missense	probably damaging	0.97
IGL02817:Chd1	APN	17	15,969,762 (GRCm39)	missense	possibly damaging	0.92
IGL03084:Chd1	APN	17	15,990,560 (GRCm39)	missense	probably benign	0.22
IGL03108:Chd1	APN	17	15,945,543 (GRCm39)	missense	possibly damaging	0.70
Holly	UTSW	17	15,946,545 (GRCm39)	missense	possibly damaging	0.72
R0053:Chd1	UTSW	17	15,967,451 (GRCm39)	missense	probably damaging	1.00
R0053:Chd1	UTSW	17	15,967,451 (GRCm39)	missense	probably damaging	1.00
R0128:Chd1	UTSW	17	17,613,829 (GRCm39)	missense	probably damaging	1.00
R0197:Chd1	UTSW	17	15,945,693 (GRCm39)	missense	probably benign
R0285:Chd1	UTSW	17	17,594,942 (GRCm39)	splice site	probably benign
R0326:Chd1	UTSW	17	15,988,830 (GRCm39)	missense	probably benign
R0326:Chd1	UTSW	17	15,988,828 (GRCm39)	missense	probably damaging	1.00
R0372:Chd1	UTSW	17	17,607,552 (GRCm39)	missense	probably benign	0.14
R0391:Chd1	UTSW	17	15,970,156 (GRCm39)	missense	probably damaging	1.00
R0486:Chd1	UTSW	17	15,954,604 (GRCm39)	missense	probably damaging	0.99
R0637:Chd1	UTSW	17	15,962,550 (GRCm39)	missense	possibly damaging	0.50
R0675:Chd1	UTSW	17	15,978,523 (GRCm39)	unclassified	probably benign
R0701:Chd1	UTSW	17	15,945,693 (GRCm39)	missense	probably benign
R0788:Chd1	UTSW	17	15,927,376 (GRCm39)	missense	possibly damaging	0.86
R0848:Chd1	UTSW	17	15,990,503 (GRCm39)	missense	probably damaging	1.00
R0883:Chd1	UTSW	17	15,945,693 (GRCm39)	missense	probably benign
R1169:Chd1	UTSW	17	15,955,994 (GRCm39)	missense	probably damaging	1.00
R1218:Chd1	UTSW	17	15,945,574 (GRCm39)	missense	probably damaging	1.00
R1370:Chd1	UTSW	17	17,607,742 (GRCm39)	missense	probably benign	0.00
R1470:Chd1	UTSW	17	15,946,545 (GRCm39)	missense	possibly damaging	0.72
R1470:Chd1	UTSW	17	15,946,545 (GRCm39)	missense	possibly damaging	0.72
R1478:Chd1	UTSW	17	15,959,769 (GRCm39)	missense	probably damaging	0.99
R1752:Chd1	UTSW	17	15,963,494 (GRCm39)	critical splice donor site	probably null
R1759:Chd1	UTSW	17	17,607,533 (GRCm39)	missense	probably benign	0.00
R1767:Chd1	UTSW	17	15,990,565 (GRCm39)	missense	probably damaging	1.00
R1938:Chd1	UTSW	17	15,982,748 (GRCm39)	missense	probably benign	0.39
R2007:Chd1	UTSW	17	15,951,268 (GRCm39)	missense	probably damaging	1.00
R2069:Chd1	UTSW	17	15,962,556 (GRCm39)	missense	probably damaging	1.00
R3771:Chd1	UTSW	17	17,594,913 (GRCm39)	missense	probably damaging	1.00
R3773:Chd1	UTSW	17	17,594,913 (GRCm39)	missense	probably damaging	1.00
R3849:Chd1	UTSW	17	15,952,133 (GRCm39)	missense	probably damaging	1.00
R4241:Chd1	UTSW	17	15,990,289 (GRCm39)	nonsense	probably null
R4242:Chd1	UTSW	17	15,990,289 (GRCm39)	nonsense	probably null
R4354:Chd1	UTSW	17	17,610,263 (GRCm39)	missense	probably benign	0.23
R4468:Chd1	UTSW	17	15,980,657 (GRCm39)	missense	probably damaging	0.99
R4469:Chd1	UTSW	17	15,980,657 (GRCm39)	missense	probably damaging	0.99
R4731:Chd1	UTSW	17	17,598,079 (GRCm39)	missense	probably benign	0.36
R4824:Chd1	UTSW	17	15,953,386 (GRCm39)	missense	probably damaging	1.00
R4840:Chd1	UTSW	17	15,989,016 (GRCm39)	missense	probably damaging	1.00
R4840:Chd1	UTSW	17	15,989,015 (GRCm39)	nonsense	probably null
R4880:Chd1	UTSW	17	17,594,916 (GRCm39)	missense	probably damaging	1.00
R4960:Chd1	UTSW	17	15,962,493 (GRCm39)	missense	probably damaging	0.96
R5071:Chd1	UTSW	17	15,982,667 (GRCm39)	missense	probably benign
R5078:Chd1	UTSW	17	15,946,616 (GRCm39)	missense	possibly damaging	0.93
R5114:Chd1	UTSW	17	15,948,460 (GRCm39)	missense	probably benign	0.25
R5268:Chd1	UTSW	17	15,956,005 (GRCm39)	missense	probably damaging	1.00
R5304:Chd1	UTSW	17	15,990,530 (GRCm39)	missense	possibly damaging	0.55
R5304:Chd1	UTSW	17	15,975,213 (GRCm39)	missense	probably benign	0.01
R5307:Chd1	UTSW	17	15,952,832 (GRCm39)	missense	probably damaging	1.00
R5458:Chd1	UTSW	17	15,958,811 (GRCm39)	missense	probably damaging	1.00
R5623:Chd1	UTSW	17	15,975,194 (GRCm39)	missense	probably damaging	1.00
R6022:Chd1	UTSW	17	17,598,035 (GRCm39)	missense	probably benign	0.39
R6137:Chd1	UTSW	17	15,978,950 (GRCm39)	missense	probably damaging	1.00
R6257:Chd1	UTSW	17	15,950,465 (GRCm39)	splice site	probably null
R6373:Chd1	UTSW	17	15,958,898 (GRCm39)	missense	probably damaging	1.00
R6458:Chd1	UTSW	17	15,950,864 (GRCm39)	missense	probably benign	0.01
R6476:Chd1	UTSW	17	17,601,250 (GRCm39)	critical splice donor site	probably null
R6508:Chd1	UTSW	17	15,958,895 (GRCm39)	missense	probably benign	0.31
R6553:Chd1	UTSW	17	15,945,692 (GRCm39)	missense	probably benign	0.00
R6745:Chd1	UTSW	17	17,607,429 (GRCm39)	missense	probably benign	0.08
R7107:Chd1	UTSW	17	15,981,628 (GRCm39)	missense	probably damaging	0.98
R7230:Chd1	UTSW	17	15,927,199 (GRCm39)	splice site	probably null
R7317:Chd1	UTSW	17	15,962,536 (GRCm39)	missense	possibly damaging	0.71
R7341:Chd1	UTSW	17	15,990,499 (GRCm39)	missense	probably damaging	0.99
R7421:Chd1	UTSW	17	15,969,660 (GRCm39)	missense	probably benign	0.03
R7704:Chd1	UTSW	17	15,987,737 (GRCm39)	missense	probably benign
R7763:Chd1	UTSW	17	15,953,303 (GRCm39)	missense	probably damaging	1.00
R8156:Chd1	UTSW	17	15,981,666 (GRCm39)	missense	probably benign
R8194:Chd1	UTSW	17	17,594,737 (GRCm39)	start gained	probably benign
R8261:Chd1	UTSW	17	17,607,804 (GRCm39)	missense	probably benign	0.02
R8338:Chd1	UTSW	17	15,990,242 (GRCm39)	missense	probably damaging	1.00
R8401:Chd1	UTSW	17	15,963,473 (GRCm39)	missense	probably damaging	1.00
R8411:Chd1	UTSW	17	15,982,711 (GRCm39)	missense	probably damaging	0.98
R9067:Chd1	UTSW	17	15,951,107 (GRCm39)	missense	possibly damaging	0.49
R9184:Chd1	UTSW	17	15,962,551 (GRCm39)	missense	possibly damaging	0.71
R9210:Chd1	UTSW	17	15,950,767 (GRCm39)	missense	possibly damaging	0.70
R9212:Chd1	UTSW	17	15,950,767 (GRCm39)	missense	possibly damaging	0.70
R9666:Chd1	UTSW	17	15,955,976 (GRCm39)	missense	probably damaging	1.00
R9673:Chd1	UTSW	17	15,989,023 (GRCm39)	missense	probably benign	0.24
Z1176:Chd1	UTSW	17	15,988,995 (GRCm39)	missense	probably damaging	1.00
Z1176:Chd1	UTSW	17	15,986,609 (GRCm39)	missense	probably damaging	0.98
Z1177:Chd1	UTSW	17	15,968,063 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGAGCCATTTATTCAAGCAGAAC -3'
(R):5'- GGGCTATGAATATTTGATACAGCAG -3'

Sequencing Primer
(F):5'- GCCATTTATTCAAGCAGAACTTCAAG -3'
(R):5'- GTGGCTCACAAACATCTATAATGGG -3'

Posted On

2016-10-24