Incidental Mutation 'R5553:Vmn2r100'
ID435242
Institutional Source Beutler Lab
Gene Symbol Vmn2r100
Ensembl Gene ENSMUSG00000091859
Gene Namevomeronasal 2, receptor 100
SynonymsEG627537
MMRRC Submission 043110-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5553 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location19504732-19535231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19504848 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 13 (Q13R)
Ref Sequence ENSEMBL: ENSMUSP00000156263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166081] [ENSMUST00000231465]
Predicted Effect probably benign
Transcript: ENSMUST00000166081
AA Change: Q13R

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128350
Gene: ENSMUSG00000091859
AA Change: Q13R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 456 7.4e-41 PFAM
Pfam:NCD3G 510 563 1.9e-21 PFAM
Pfam:7tm_3 594 831 2.6e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000231465
AA Change: Q13R

PolyPhen 2 Score 0.642 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,920,841 I86F probably damaging Het
Abca13 C T 11: 9,328,158 L3113F probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Ano8 T A 8: 71,484,997 probably null Het
Arid1b A T 17: 5,313,877 S1041C probably damaging Het
Bsn T A 9: 108,110,421 probably benign Het
Cbr3 A G 16: 93,683,563 E80G possibly damaging Het
Chd1 A G 17: 17,385,613 E271G probably benign Het
Dock3 T A 9: 106,991,110 K658N possibly damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dppa1 T A 11: 46,613,034 probably null Het
Fam129a C T 1: 151,717,235 T557M probably damaging Het
Fen1 T C 19: 10,200,423 N219S probably benign Het
Fsip2 A G 2: 82,962,746 T416A probably benign Het
Gm14393 A T 2: 175,061,846 C89* probably null Het
Grin2c C T 11: 115,252,725 M736I probably null Het
Heatr5b A T 17: 78,753,351 probably null Het
Hspbap1 G T 16: 35,801,597 W104L probably damaging Het
Igfn1 C T 1: 135,967,884 G1648E probably damaging Het
Irf4 A G 13: 30,751,828 Y122C probably damaging Het
Kremen2 A G 17: 23,741,802 probably benign Het
Nubpl T A 12: 52,181,299 L169M possibly damaging Het
Nwd1 T C 8: 72,704,976 S1200P possibly damaging Het
Olfr352 A G 2: 36,870,465 I300V probably benign Het
Olfr485 A T 7: 108,159,271 S201T probably benign Het
Parp14 G T 16: 35,856,936 H887Q probably benign Het
Paxip1 G A 5: 27,775,639 probably benign Het
Piwil1 T C 5: 128,745,501 M392T probably benign Het
Plekhm3 T C 1: 64,921,886 S404G possibly damaging Het
Prelid3a T C 18: 67,477,023 L141P probably damaging Het
Ptprb T A 10: 116,350,185 V1715E probably damaging Het
Rc3h2 G A 2: 37,398,311 R420* probably null Het
Selenon C A 4: 134,540,917 R435L probably damaging Het
Slc29a4 T C 5: 142,720,036 L425P probably damaging Het
Slc30a9 T A 5: 67,345,604 probably null Het
Slc9a5 T C 8: 105,357,040 V404A probably damaging Het
Ssc5d A T 7: 4,936,290 D575V probably damaging Het
Ttn A C 2: 76,891,596 probably null Het
Wfikkn1 T A 17: 25,878,494 L285F possibly damaging Het
Zcchc17 A G 4: 130,354,134 probably null Het
Other mutations in Vmn2r100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Vmn2r100 APN 17 19526000 missense probably damaging 1.00
IGL00912:Vmn2r100 APN 17 19531392 missense possibly damaging 0.95
IGL01107:Vmn2r100 APN 17 19521356 missense probably damaging 1.00
IGL01517:Vmn2r100 APN 17 19521963 missense probably benign 0.37
IGL01594:Vmn2r100 APN 17 19531233 missense possibly damaging 0.52
IGL01657:Vmn2r100 APN 17 19525916 missense possibly damaging 0.89
IGL01822:Vmn2r100 APN 17 19504838 missense probably null 0.00
IGL02020:Vmn2r100 APN 17 19504938 missense possibly damaging 0.78
IGL02060:Vmn2r100 APN 17 19521254 missense possibly damaging 0.79
IGL02126:Vmn2r100 APN 17 19521242 splice site probably benign
IGL02142:Vmn2r100 APN 17 19522321 missense probably damaging 1.00
IGL02308:Vmn2r100 APN 17 19521335 missense possibly damaging 0.90
IGL02407:Vmn2r100 APN 17 19521508 missense probably damaging 0.98
IGL02469:Vmn2r100 APN 17 19531285 nonsense probably null
IGL03088:Vmn2r100 APN 17 19522039 missense probably benign 0.27
IGL03181:Vmn2r100 APN 17 19531945 missense probably damaging 1.00
IGL03405:Vmn2r100 APN 17 19531924 missense probably damaging 1.00
H8562:Vmn2r100 UTSW 17 19521490 missense possibly damaging 0.87
R0012:Vmn2r100 UTSW 17 19504874 missense probably benign
R0012:Vmn2r100 UTSW 17 19526034 missense probably damaging 0.99
R0044:Vmn2r100 UTSW 17 19522179 missense possibly damaging 0.46
R0109:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0111:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0112:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0149:Vmn2r100 UTSW 17 19521247 critical splice acceptor site probably null
R0355:Vmn2r100 UTSW 17 19531320 missense probably benign 0.00
R0395:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0396:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0453:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0465:Vmn2r100 UTSW 17 19531530 missense probably damaging 0.98
R0477:Vmn2r100 UTSW 17 19522514 missense probably benign 0.00
R0510:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0512:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0514:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0518:Vmn2r100 UTSW 17 19521916 missense probably damaging 1.00
R0521:Vmn2r100 UTSW 17 19521916 missense probably damaging 1.00
R0555:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0608:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0959:Vmn2r100 UTSW 17 19523524 missense possibly damaging 0.95
R1114:Vmn2r100 UTSW 17 19531999 missense probably damaging 1.00
R2027:Vmn2r100 UTSW 17 19522072 missense probably benign 0.02
R2049:Vmn2r100 UTSW 17 19522050 missense probably benign 0.00
R2224:Vmn2r100 UTSW 17 19522372 missense probably benign 0.03
R2226:Vmn2r100 UTSW 17 19522372 missense probably benign 0.03
R3618:Vmn2r100 UTSW 17 19523430 missense probably benign
R3715:Vmn2r100 UTSW 17 19532010 missense probably damaging 0.99
R4120:Vmn2r100 UTSW 17 19531953 missense probably damaging 1.00
R4152:Vmn2r100 UTSW 17 19523419 frame shift probably null
R4153:Vmn2r100 UTSW 17 19523419 frame shift probably null
R4154:Vmn2r100 UTSW 17 19523419 frame shift probably null
R4200:Vmn2r100 UTSW 17 19522535 missense probably benign 0.29
R4632:Vmn2r100 UTSW 17 19531954 missense probably damaging 1.00
R4720:Vmn2r100 UTSW 17 19522526 missense probably benign 0.02
R4761:Vmn2r100 UTSW 17 19521368 missense possibly damaging 0.47
R4831:Vmn2r100 UTSW 17 19521410 missense probably benign 0.28
R4951:Vmn2r100 UTSW 17 19532038 missense probably benign 0.01
R5211:Vmn2r100 UTSW 17 19525995 missense possibly damaging 0.67
R5657:Vmn2r100 UTSW 17 19504916 missense probably benign 0.31
R5883:Vmn2r100 UTSW 17 19523524 missense probably benign
R5912:Vmn2r100 UTSW 17 19531809 missense probably damaging 0.99
R6141:Vmn2r100 UTSW 17 19522314 missense probably benign 0.07
R6146:Vmn2r100 UTSW 17 19522260 missense probably benign 0.04
R6500:Vmn2r100 UTSW 17 19522093 missense probably damaging 1.00
R6575:Vmn2r100 UTSW 17 19521409 missense probably benign 0.12
R6647:Vmn2r100 UTSW 17 19522523 missense probably benign 0.00
X0062:Vmn2r100 UTSW 17 19531390 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GTGGCATTCTCAATCCCTTGG -3'
(R):5'- GCCTCTAAGTCATGAGAATTCAGAC -3'

Sequencing Primer
(F):5'- CTCAATCCCTTGGAATGATTAGTGTG -3'
(R):5'- ATTGTACGTACTGTATGTAATTGTCC -3'
Posted On2016-10-24