Incidental Mutation 'R5553:Kremen2'
ID435243
Institutional Source Beutler Lab
Gene Symbol Kremen2
Ensembl Gene ENSMUSG00000040680
Gene Namekringle containing transmembrane protein 2
Synonyms2900054E04Rik, Krm2
MMRRC Submission 043110-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R5553 (G1)
Quality Score207
Status Not validated
Chromosome17
Chromosomal Location23741197-23745833 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 23741802 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024702] [ENSMUST00000046525]
Predicted Effect probably benign
Transcript: ENSMUST00000024702
SMART Domains Protein: ENSMUSP00000024702
Gene: ENSMUSG00000023909

DomainStartEndE-ValueType
Pfam:HlyIII 43 254 1e-26 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000046525
AA Change: S449P
SMART Domains Protein: ENSMUSP00000046369
Gene: ENSMUSG00000040680
AA Change: S449P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
KR 33 120 2.44e-18 SMART
Pfam:WSC 123 204 1.3e-20 PFAM
CUB 218 325 8.04e-15 SMART
Blast:CUB 351 422 8e-6 BLAST
low complexity region 446 461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181291
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high-affinity dickkopf homolog 1 (DKK1) transmembrane receptor. A similar protein in mouse functions interacts with with DKK1 to block wingless (WNT)/beta-catenin signaling. The encoded protein forms a ternary membrane complex with DKK1 and the WNT receptor lipoprotein receptor-related protein 6 (LRP6), and induces rapid endocytosis and removal of LRP6 from the plasma membrane. It contains extracellular kringle, WSC, and CUB domains. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,920,841 I86F probably damaging Het
Abca13 C T 11: 9,328,158 L3113F probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Ano8 T A 8: 71,484,997 probably null Het
Arid1b A T 17: 5,313,877 S1041C probably damaging Het
Bsn T A 9: 108,110,421 probably benign Het
Cbr3 A G 16: 93,683,563 E80G possibly damaging Het
Chd1 A G 17: 17,385,613 E271G probably benign Het
Dock3 T A 9: 106,991,110 K658N possibly damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dppa1 T A 11: 46,613,034 probably null Het
Fam129a C T 1: 151,717,235 T557M probably damaging Het
Fen1 T C 19: 10,200,423 N219S probably benign Het
Fsip2 A G 2: 82,962,746 T416A probably benign Het
Gm14393 A T 2: 175,061,846 C89* probably null Het
Grin2c C T 11: 115,252,725 M736I probably null Het
Heatr5b A T 17: 78,753,351 probably null Het
Hspbap1 G T 16: 35,801,597 W104L probably damaging Het
Igfn1 C T 1: 135,967,884 G1648E probably damaging Het
Irf4 A G 13: 30,751,828 Y122C probably damaging Het
Nubpl T A 12: 52,181,299 L169M possibly damaging Het
Nwd1 T C 8: 72,704,976 S1200P possibly damaging Het
Olfr352 A G 2: 36,870,465 I300V probably benign Het
Olfr485 A T 7: 108,159,271 S201T probably benign Het
Parp14 G T 16: 35,856,936 H887Q probably benign Het
Paxip1 G A 5: 27,775,639 probably benign Het
Piwil1 T C 5: 128,745,501 M392T probably benign Het
Plekhm3 T C 1: 64,921,886 S404G possibly damaging Het
Prelid3a T C 18: 67,477,023 L141P probably damaging Het
Ptprb T A 10: 116,350,185 V1715E probably damaging Het
Rc3h2 G A 2: 37,398,311 R420* probably null Het
Selenon C A 4: 134,540,917 R435L probably damaging Het
Slc29a4 T C 5: 142,720,036 L425P probably damaging Het
Slc30a9 T A 5: 67,345,604 probably null Het
Slc9a5 T C 8: 105,357,040 V404A probably damaging Het
Ssc5d A T 7: 4,936,290 D575V probably damaging Het
Ttn A C 2: 76,891,596 probably null Het
Vmn2r100 A G 17: 19,504,848 Q13R possibly damaging Het
Wfikkn1 T A 17: 25,878,494 L285F possibly damaging Het
Zcchc17 A G 4: 130,354,134 probably null Het
Other mutations in Kremen2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02327:Kremen2 APN 17 23743569 missense probably benign 0.11
R0057:Kremen2 UTSW 17 23743228 missense possibly damaging 0.94
R0369:Kremen2 UTSW 17 23742810 missense probably benign 0.02
R0835:Kremen2 UTSW 17 23742837 missense probably damaging 0.99
R0847:Kremen2 UTSW 17 23744660 missense probably damaging 1.00
R1733:Kremen2 UTSW 17 23743399 intron probably null
R2056:Kremen2 UTSW 17 23742717 missense possibly damaging 0.94
R2057:Kremen2 UTSW 17 23742717 missense possibly damaging 0.94
R2058:Kremen2 UTSW 17 23742717 missense possibly damaging 0.94
R2173:Kremen2 UTSW 17 23742796 missense probably damaging 0.98
R5583:Kremen2 UTSW 17 23742255 missense probably benign 0.00
R6057:Kremen2 UTSW 17 23742705 missense probably benign 0.00
R6510:Kremen2 UTSW 17 23743655 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TCTGGTCTTCCCGAGATGATC -3'
(R):5'- TTTGCAGGCAGAGCAGGATG -3'

Sequencing Primer
(F):5'- GTCTTCCCGAGATGATCAGAGAC -3'
(R):5'- TATGGGTCCAGCTGACGTC -3'
Posted On2016-10-24