Incidental Mutation 'R5553:Wfikkn1'
ID435244
Institutional Source Beutler Lab
Gene Symbol Wfikkn1
Ensembl Gene ENSMUSG00000071192
Gene NameWAP, FS, Ig, KU, and NTR-containing protein 1
Synonyms
MMRRC Submission 043110-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R5553 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25877630-25880305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25878494 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 285 (L285F)
Ref Sequence ENSEMBL: ENSMUSP00000093141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026826] [ENSMUST00000026827] [ENSMUST00000095487] [ENSMUST00000110456] [ENSMUST00000163356] [ENSMUST00000166146] [ENSMUST00000167626] [ENSMUST00000169085] [ENSMUST00000169308] [ENSMUST00000176696] [ENSMUST00000179998]
Predicted Effect probably benign
Transcript: ENSMUST00000026826
SMART Domains Protein: ENSMUSP00000026826
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
RAB 15 177 9.2e-77 SMART
SOCS 183 226 1.6e-18 SMART
SOCS_box 189 225 7.2e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026827
SMART Domains Protein: ENSMUSP00000026827
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 203 7.4e-95 PFAM
Pfam:Methyltransf_25 31 133 1.1e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000095487
AA Change: L285F

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000093141
Gene: ENSMUSG00000071192
AA Change: L285F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 32 82 4.04e-3 SMART
KAZAL 119 161 1.96e-2 SMART
IGc2 202 274 2.54e-14 SMART
KU 301 356 4.2e-3 SMART
KU 361 414 1.82e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110456
SMART Domains Protein: ENSMUSP00000106086
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 78 8.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163356
SMART Domains Protein: ENSMUSP00000130209
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 172 1.6e-74 PFAM
Pfam:Methyltransf_25 31 133 9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166146
SMART Domains Protein: ENSMUSP00000132355
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
SCOP:d3raba_ 10 43 3e-9 SMART
Blast:RAB 15 49 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166619
Predicted Effect probably benign
Transcript: ENSMUST00000167626
SMART Domains Protein: ENSMUSP00000127546
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
RAB 15 177 9.2e-77 SMART
SOCS 183 226 1.6e-18 SMART
SOCS_box 189 225 7.2e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169085
SMART Domains Protein: ENSMUSP00000125990
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 65 6.5e-29 PFAM
Pfam:DUF938 64 106 3.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169308
SMART Domains Protein: ENSMUSP00000126198
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 194 5.6e-86 PFAM
Pfam:Methyltransf_25 31 133 4.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176696
SMART Domains Protein: ENSMUSP00000135083
Gene: ENSMUSG00000071192

DomainStartEndE-ValueType
WAP 2 48 8.8e-2 SMART
KAZAL 85 127 1.96e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179998
SMART Domains Protein: ENSMUSP00000136612
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
RAB 15 177 9.4e-77 SMART
SOCS 183 226 1.7e-18 SMART
SOCS_box 189 225 7.3e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted multidomain protein consisting of a signal peptide, a WAP domain, a follistatin domain, an immunoglobulin domain, two tandem Kunitz domains, and an NTR domain. These domains have been implicated frequently in inhibition of various types of proteases, suggesting that the encoded protein may be a multivalent protease inhibitor and may control the action of multiple types of serine proteases as well as metalloproteinases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show partial penetrance of posteriorly directed homeotic transformations throughout the axial skeleton, impaired muscle regeneration and a mild decrease in skeletal muscle weight in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,920,841 I86F probably damaging Het
Abca13 C T 11: 9,328,158 L3113F probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Ano8 T A 8: 71,484,997 probably null Het
Arid1b A T 17: 5,313,877 S1041C probably damaging Het
Bsn T A 9: 108,110,421 probably benign Het
Cbr3 A G 16: 93,683,563 E80G possibly damaging Het
Chd1 A G 17: 17,385,613 E271G probably benign Het
Dock3 T A 9: 106,991,110 K658N possibly damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dppa1 T A 11: 46,613,034 probably null Het
Fam129a C T 1: 151,717,235 T557M probably damaging Het
Fen1 T C 19: 10,200,423 N219S probably benign Het
Fsip2 A G 2: 82,962,746 T416A probably benign Het
Gm14393 A T 2: 175,061,846 C89* probably null Het
Grin2c C T 11: 115,252,725 M736I probably null Het
Heatr5b A T 17: 78,753,351 probably null Het
Hspbap1 G T 16: 35,801,597 W104L probably damaging Het
Igfn1 C T 1: 135,967,884 G1648E probably damaging Het
Irf4 A G 13: 30,751,828 Y122C probably damaging Het
Kremen2 A G 17: 23,741,802 probably benign Het
Nubpl T A 12: 52,181,299 L169M possibly damaging Het
Nwd1 T C 8: 72,704,976 S1200P possibly damaging Het
Olfr352 A G 2: 36,870,465 I300V probably benign Het
Olfr485 A T 7: 108,159,271 S201T probably benign Het
Parp14 G T 16: 35,856,936 H887Q probably benign Het
Paxip1 G A 5: 27,775,639 probably benign Het
Piwil1 T C 5: 128,745,501 M392T probably benign Het
Plekhm3 T C 1: 64,921,886 S404G possibly damaging Het
Prelid3a T C 18: 67,477,023 L141P probably damaging Het
Ptprb T A 10: 116,350,185 V1715E probably damaging Het
Rc3h2 G A 2: 37,398,311 R420* probably null Het
Selenon C A 4: 134,540,917 R435L probably damaging Het
Slc29a4 T C 5: 142,720,036 L425P probably damaging Het
Slc30a9 T A 5: 67,345,604 probably null Het
Slc9a5 T C 8: 105,357,040 V404A probably damaging Het
Ssc5d A T 7: 4,936,290 D575V probably damaging Het
Ttn A C 2: 76,891,596 probably null Het
Vmn2r100 A G 17: 19,504,848 Q13R possibly damaging Het
Zcchc17 A G 4: 130,354,134 probably null Het
Other mutations in Wfikkn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0731:Wfikkn1 UTSW 17 25878017 missense probably damaging 0.98
R1484:Wfikkn1 UTSW 17 25877791 missense probably benign 0.01
R1545:Wfikkn1 UTSW 17 25878591 missense probably damaging 1.00
R3689:Wfikkn1 UTSW 17 25878718 missense probably damaging 1.00
R4735:Wfikkn1 UTSW 17 25878393 missense possibly damaging 0.86
R5938:Wfikkn1 UTSW 17 25878912 missense probably damaging 1.00
R6465:Wfikkn1 UTSW 17 25878718 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCCTCATAGGTCTCAAAGC -3'
(R):5'- CACTGTGATGTTAGTGGCCG -3'

Sequencing Primer
(F):5'- TCATAGGTCTCAAAGCCCCGG -3'
(R):5'- CTGCTGTGACCTGGGAGAAG -3'
Posted On2016-10-24