Incidental Mutation 'R5555:Steap2'
ID435328
Institutional Source Beutler Lab
Gene Symbol Steap2
Ensembl Gene ENSMUSG00000015653
Gene Namesix transmembrane epithelial antigen of prostate 2
Synonyms
MMRRC Submission 043112-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5555 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location5664829-5694578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5677544 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 264 (T264A)
Ref Sequence ENSEMBL: ENSMUSP00000132501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015797] [ENSMUST00000115424] [ENSMUST00000115425] [ENSMUST00000115426] [ENSMUST00000115427] [ENSMUST00000148333] [ENSMUST00000164219]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015797
AA Change: T264A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000015797
Gene: ENSMUSG00000015653
AA Change: T264A

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 8.9e-19 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 405 2.8e-16 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115424
AA Change: T264A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111084
Gene: ENSMUSG00000015653
AA Change: T264A

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115425
AA Change: T264A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111085
Gene: ENSMUSG00000015653
AA Change: T264A

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115426
AA Change: T264A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111086
Gene: ENSMUSG00000015653
AA Change: T264A

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115427
AA Change: T264A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111087
Gene: ENSMUSG00000015653
AA Change: T264A

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 2.3e-17 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 401 1.8e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000148333
AA Change: T264A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116910
Gene: ENSMUSG00000015653
AA Change: T264A

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 8.3e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 2.7e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150238
Predicted Effect possibly damaging
Transcript: ENSMUST00000164219
AA Change: T264A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132501
Gene: ENSMUSG00000015653
AA Change: T264A

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the STEAP family and encodes a multi-pass membrane protein that localizes to the Golgi complex, the plasma membrane, and the vesicular tubular structures in the cytosol. A highly similar protein in mouse has both ferrireductase and cupric reductase activity, and stimulates the cellular uptake of both iron and copper in vitro. Increased transcriptional expression of the human gene is associated with prostate cancer progression. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,422,296 probably null Het
Atg7 T C 6: 114,702,053 V366A probably damaging Het
Cadm2 A T 16: 66,784,815 V192E probably damaging Het
Chil6 C T 3: 106,389,952 S291N possibly damaging Het
D7Ertd443e T C 7: 134,349,591 T118A probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah1 T A 14: 31,290,819 T1837S probably damaging Het
Ext1 A G 15: 53,088,143 V515A probably damaging Het
Fer1l4 T C 2: 156,048,189 E272G probably damaging Het
Fras1 T A 5: 96,677,377 H1475Q probably benign Het
Grid1 T C 14: 35,520,705 S672P possibly damaging Het
Gtpbp4 A G 13: 8,979,427 probably null Het
Hsp90aa1 A T 12: 110,692,734 V543E probably damaging Het
Irf5 T C 6: 29,531,146 S4P probably benign Het
Kif2b G T 11: 91,575,460 Q666K probably benign Het
Macc1 A T 12: 119,450,375 H762L probably benign Het
Map1s C T 8: 70,917,107 T941M probably damaging Het
Mrgprb1 T A 7: 48,447,775 I130F probably benign Het
Nbeal1 T G 1: 60,237,152 V684G possibly damaging Het
Ngly1 C T 14: 16,270,508 Q173* probably null Het
Plcb3 A T 19: 6,966,219 M104K probably benign Het
Plcg2 T A 8: 117,612,995 Y1048* probably null Het
Ptprf T C 4: 118,224,924 Y1039C probably damaging Het
Rab38 A G 7: 88,430,487 Y29C probably damaging Het
Rcan2 T A 17: 44,037,030 V210E probably damaging Het
Rptn A T 3: 93,396,701 Q447L probably benign Het
Scel G A 14: 103,602,206 R495K probably benign Het
Scn11a G T 9: 119,755,238 P1437Q probably damaging Het
Sim2 A G 16: 94,109,456 D239G probably damaging Het
Skap2 A G 6: 51,860,018 Y356H probably damaging Het
Skint11 A G 4: 114,194,601 T49A probably benign Het
Snx33 G A 9: 56,925,397 H463Y probably benign Het
Stk40 T A 4: 126,135,059 V238E probably damaging Het
Sun2 T C 15: 79,734,127 D277G probably benign Het
Ttll9 T C 2: 152,990,100 probably null Het
Vmn1r54 G A 6: 90,269,365 C87Y probably benign Het
Other mutations in Steap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Steap2 APN 5 5673586 missense probably damaging 0.99
IGL02272:Steap2 APN 5 5677612 missense probably benign 0.10
IGL02680:Steap2 APN 5 5673474 missense probably benign 0.00
R0267:Steap2 UTSW 5 5673561 missense probably benign 0.00
R1670:Steap2 UTSW 5 5677393 missense possibly damaging 0.80
R2175:Steap2 UTSW 5 5673501 missense probably damaging 1.00
R2188:Steap2 UTSW 5 5673643 nonsense probably null
R2374:Steap2 UTSW 5 5675845 missense probably damaging 0.99
R4902:Steap2 UTSW 5 5675866 missense possibly damaging 0.91
R4941:Steap2 UTSW 5 5677651 missense probably damaging 1.00
R5012:Steap2 UTSW 5 5677784 missense possibly damaging 0.48
R5571:Steap2 UTSW 5 5675912 missense probably damaging 1.00
R5666:Steap2 UTSW 5 5673681 missense probably benign 0.00
R5670:Steap2 UTSW 5 5673681 missense probably benign 0.00
R5677:Steap2 UTSW 5 5677497 nonsense probably null
R6101:Steap2 UTSW 5 5675891 missense possibly damaging 0.71
R6105:Steap2 UTSW 5 5675891 missense possibly damaging 0.71
R6190:Steap2 UTSW 5 5675881 missense probably damaging 1.00
R7172:Steap2 UTSW 5 5682896 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GCTGATAAGCCATGTTGAGGAAC -3'
(R):5'- CGACTGTTTACTCTCTGGAGGG -3'

Sequencing Primer
(F):5'- TGAGGAACAGGTATCTTTCCGACC -3'
(R):5'- GGGCCAGTGGTAGTAGCCATAAG -3'
Posted On2016-10-24