Incidental Mutation 'R5555:Skap2'
ID435332
Institutional Source Beutler Lab
Gene Symbol Skap2
Ensembl Gene ENSMUSG00000059182
Gene Namesrc family associated phosphoprotein 2
SynonymsSaps, RA70, SKAP-HOM, mSKAP55R, 2610021A10Rik
MMRRC Submission 043112-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5555 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location51857422-52012549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51860018 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 356 (Y356H)
Ref Sequence ENSEMBL: ENSMUSP00000145462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078214] [ENSMUST00000203948] [ENSMUST00000204778]
Predicted Effect probably damaging
Transcript: ENSMUST00000078214
AA Change: Y349H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077342
Gene: ENSMUSG00000059182
AA Change: Y349H

DomainStartEndE-ValueType
PH 117 221 6.11e-18 SMART
low complexity region 254 269 N/A INTRINSIC
SH3 299 356 1.71e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203948
SMART Domains Protein: ENSMUSP00000145275
Gene: ENSMUSG00000059182

DomainStartEndE-ValueType
Blast:PH 1 49 1e-28 BLAST
PDB:1U5F|A 1 74 1e-30 PDB
SH3 83 126 3e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204778
AA Change: Y356H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145462
Gene: ENSMUSG00000059182
AA Change: Y356H

DomainStartEndE-ValueType
PH 117 221 6.11e-18 SMART
low complexity region 254 269 N/A INTRINSIC
SH3 299 356 1.71e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205174
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares homology with Src kinase-associated phosphoprotein 1, and is a substrate of Src family kinases. It is an adaptor protein that is thought to play an essential role in the Src signaling pathway, and in regulating proper activation of the immune system. This protein contains an amino terminal coiled-coil domain for self-dimerization, a plecskstrin homology (PH) domain required for interactions with lipids at the membrane, and a Src homology (SH3) domain at the carboxy terminus. Some reports indicate that this protein inhibits actin polymerization through interactions with actin assembly factors, and might negatively regulate the invasiveness of tumors by modulating actin assembly. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null allele are embryonic lethal. Homozygotes for a gene-trapped allele show impaired B-cell responses and B-cell adhesion, decreased susceptibility to EAE, abnormal dendritic cell physiology, fast extinction of fear memory, and impaired social memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,422,296 probably null Het
Atg7 T C 6: 114,702,053 V366A probably damaging Het
Cadm2 A T 16: 66,784,815 V192E probably damaging Het
Chil6 C T 3: 106,389,952 S291N possibly damaging Het
D7Ertd443e T C 7: 134,349,591 T118A probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah1 T A 14: 31,290,819 T1837S probably damaging Het
Ext1 A G 15: 53,088,143 V515A probably damaging Het
Fer1l4 T C 2: 156,048,189 E272G probably damaging Het
Fras1 T A 5: 96,677,377 H1475Q probably benign Het
Grid1 T C 14: 35,520,705 S672P possibly damaging Het
Gtpbp4 A G 13: 8,979,427 probably null Het
Hsp90aa1 A T 12: 110,692,734 V543E probably damaging Het
Irf5 T C 6: 29,531,146 S4P probably benign Het
Kif2b G T 11: 91,575,460 Q666K probably benign Het
Macc1 A T 12: 119,450,375 H762L probably benign Het
Map1s C T 8: 70,917,107 T941M probably damaging Het
Mrgprb1 T A 7: 48,447,775 I130F probably benign Het
Nbeal1 T G 1: 60,237,152 V684G possibly damaging Het
Ngly1 C T 14: 16,270,508 Q173* probably null Het
Plcb3 A T 19: 6,966,219 M104K probably benign Het
Plcg2 T A 8: 117,612,995 Y1048* probably null Het
Ptprf T C 4: 118,224,924 Y1039C probably damaging Het
Rab38 A G 7: 88,430,487 Y29C probably damaging Het
Rcan2 T A 17: 44,037,030 V210E probably damaging Het
Rptn A T 3: 93,396,701 Q447L probably benign Het
Scel G A 14: 103,602,206 R495K probably benign Het
Scn11a G T 9: 119,755,238 P1437Q probably damaging Het
Sim2 A G 16: 94,109,456 D239G probably damaging Het
Skint11 A G 4: 114,194,601 T49A probably benign Het
Snx33 G A 9: 56,925,397 H463Y probably benign Het
Steap2 T C 5: 5,677,544 T264A possibly damaging Het
Stk40 T A 4: 126,135,059 V238E probably damaging Het
Sun2 T C 15: 79,734,127 D277G probably benign Het
Ttll9 T C 2: 152,990,100 probably null Het
Vmn1r54 G A 6: 90,269,365 C87Y probably benign Het
Other mutations in Skap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Skap2 APN 6 51921300 missense probably damaging 1.00
IGL01526:Skap2 APN 6 51907914 missense probably benign 0.20
IGL01543:Skap2 APN 6 52012395 missense possibly damaging 0.88
IGL01879:Skap2 APN 6 51996034 missense possibly damaging 0.90
IGL01893:Skap2 APN 6 51874576 missense probably damaging 1.00
IGL02154:Skap2 APN 6 52012328 splice site probably benign
IGL02406:Skap2 APN 6 51874473 critical splice donor site probably null
IGL02409:Skap2 APN 6 51907958 missense possibly damaging 0.51
IGL02937:Skap2 APN 6 51909371 missense probably benign 0.01
R0648:Skap2 UTSW 6 51879785 missense probably benign 0.05
R1465:Skap2 UTSW 6 51909368 missense probably benign 0.00
R1465:Skap2 UTSW 6 51909368 missense probably benign 0.00
R2370:Skap2 UTSW 6 51921330 missense probably damaging 1.00
R3837:Skap2 UTSW 6 51909299 critical splice donor site probably null
R4847:Skap2 UTSW 6 52003669 missense probably benign 0.01
R4939:Skap2 UTSW 6 51922323 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CACAGCTGGTTATTATCAAAGGAAC -3'
(R):5'- GTTCCATTTGCAGCTCCAGC -3'

Sequencing Primer
(F):5'- TCTGTTCACTTCCAAAGTAAATTCTC -3'
(R):5'- TGCAGCTCCAGCACTTGTAG -3'
Posted On2016-10-24