Incidental Mutation 'R5555:Rab38'
ID435337
Institutional Source Beutler Lab
Gene Symbol Rab38
Ensembl Gene ENSMUSG00000030559
Gene NameRAB38, member RAS oncogene family
Synonyms2310011F14Rik
MMRRC Submission 043112-MU
Accession Numbers

Genbank: NM_028238; MGI: 1919683

Is this an essential gene? Possibly non essential (E-score: 0.425) question?
Stock #R5555 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location88430273-88491572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88430487 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 29 (Y29C)
Ref Sequence ENSEMBL: ENSMUSP00000102877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107256] [ENSMUST00000208478]
Predicted Effect probably damaging
Transcript: ENSMUST00000107256
AA Change: Y29C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102877
Gene: ENSMUSG00000030559
AA Change: Y29C

DomainStartEndE-ValueType
RAB 10 180 8.9e-84 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000208478
AA Change: Y29C

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous mutation display oculocutaneous albinism, abnormal lung alveolar structure and aberrant pulmonary surfactant homeostasis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Spontaneous(1)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,422,296 probably null Het
Atg7 T C 6: 114,702,053 V366A probably damaging Het
Cadm2 A T 16: 66,784,815 V192E probably damaging Het
Chil6 C T 3: 106,389,952 S291N possibly damaging Het
D7Ertd443e T C 7: 134,349,591 T118A probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah1 T A 14: 31,290,819 T1837S probably damaging Het
Ext1 A G 15: 53,088,143 V515A probably damaging Het
Fer1l4 T C 2: 156,048,189 E272G probably damaging Het
Fras1 T A 5: 96,677,377 H1475Q probably benign Het
Grid1 T C 14: 35,520,705 S672P possibly damaging Het
Gtpbp4 A G 13: 8,979,427 probably null Het
Hsp90aa1 A T 12: 110,692,734 V543E probably damaging Het
Irf5 T C 6: 29,531,146 S4P probably benign Het
Kif2b G T 11: 91,575,460 Q666K probably benign Het
Macc1 A T 12: 119,450,375 H762L probably benign Het
Map1s C T 8: 70,917,107 T941M probably damaging Het
Mrgprb1 T A 7: 48,447,775 I130F probably benign Het
Nbeal1 T G 1: 60,237,152 V684G possibly damaging Het
Ngly1 C T 14: 16,270,508 Q173* probably null Het
Plcb3 A T 19: 6,966,219 M104K probably benign Het
Plcg2 T A 8: 117,612,995 Y1048* probably null Het
Ptprf T C 4: 118,224,924 Y1039C probably damaging Het
Rcan2 T A 17: 44,037,030 V210E probably damaging Het
Rptn A T 3: 93,396,701 Q447L probably benign Het
Scel G A 14: 103,602,206 R495K probably benign Het
Scn11a G T 9: 119,755,238 P1437Q probably damaging Het
Sim2 A G 16: 94,109,456 D239G probably damaging Het
Skap2 A G 6: 51,860,018 Y356H probably damaging Het
Skint11 A G 4: 114,194,601 T49A probably benign Het
Snx33 G A 9: 56,925,397 H463Y probably benign Het
Steap2 T C 5: 5,677,544 T264A possibly damaging Het
Stk40 T A 4: 126,135,059 V238E probably damaging Het
Sun2 T C 15: 79,734,127 D277G probably benign Het
Ttll9 T C 2: 152,990,100 probably null Het
Vmn1r54 G A 6: 90,269,365 C87Y probably benign Het
Other mutations in Rab38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Rab38 APN 7 88430532 missense probably damaging 1.00
fenrir UTSW 7 88450541 missense probably damaging 1.00
3370:Rab38 UTSW 7 88490651 missense probably benign 0.00
R0130:Rab38 UTSW 7 88450541 missense probably damaging 1.00
R1842:Rab38 UTSW 7 88450522 missense possibly damaging 0.88
R1893:Rab38 UTSW 7 88490716 missense probably benign
R4448:Rab38 UTSW 7 88490625 missense probably benign 0.01
R4635:Rab38 UTSW 7 88450646 missense probably damaging 0.99
R6415:Rab38 UTSW 7 88430540 missense possibly damaging 0.95
R6838:Rab38 UTSW 7 88450709 missense possibly damaging 0.94
R7383:Rab38 UTSW 7 88430429 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TAGCCTAAGCGCCCACATAG -3'
(R):5'- ACTGGAACCGACTGAAAAGTC -3'

Sequencing Primer
(F):5'- ACATAGAGCTCCGGTCTCC -3'
(R):5'- GAAAAGTCATTTTCCACTCCCCG -3'
Posted On2016-10-24