Incidental Mutation 'R5555:Hsp90aa1'
ID435344
Institutional Source Beutler Lab
Gene Symbol Hsp90aa1
Ensembl Gene ENSMUSG00000021270
Gene Nameheat shock protein 90, alpha (cytosolic), class A member 1
Synonymshsp4, Hspca, Hsp90, Hsp86-1, Hsp89
MMRRC Submission 043112-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5555 (G1)
Quality Score186
Status Not validated
Chromosome12
Chromosomal Location110690605-110702728 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110692734 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 543 (V543E)
Ref Sequence ENSEMBL: ENSMUSP00000091921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021698] [ENSMUST00000094361] [ENSMUST00000124156] [ENSMUST00000149189] [ENSMUST00000155242]
Predicted Effect probably damaging
Transcript: ENSMUST00000021698
AA Change: V543E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021698
Gene: ENSMUSG00000021270
AA Change: V543E

DomainStartEndE-ValueType
HATPase_c 40 194 2.94e-11 SMART
Pfam:HSP90 196 733 6.7e-272 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094361
AA Change: V543E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091921
Gene: ENSMUSG00000021270
AA Change: V543E

DomainStartEndE-ValueType
HATPase_c 40 194 2.94e-11 SMART
Pfam:HSP90 196 728 2e-245 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124156
SMART Domains Protein: ENSMUSP00000121138
Gene: ENSMUSG00000021270

DomainStartEndE-ValueType
PDB:3HHU|B 1 103 1e-69 PDB
SCOP:d1byqa_ 11 103 5e-48 SMART
Blast:HATPase_c 40 103 7e-39 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145255
Predicted Effect probably benign
Transcript: ENSMUST00000149189
SMART Domains Protein: ENSMUSP00000114201
Gene: ENSMUSG00000021270

DomainStartEndE-ValueType
PDB:3HHU|B 1 98 6e-66 PDB
SCOP:d1byqa_ 11 98 2e-45 SMART
Blast:HATPase_c 40 98 2e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000155242
SMART Domains Protein: ENSMUSP00000118189
Gene: ENSMUSG00000021270

DomainStartEndE-ValueType
HATPase_c 40 194 2.94e-11 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inducible molecular chaperone that functions as a homodimer. The encoded protein aids in the proper folding of specific target proteins by use of an ATPase activity that is modulated by co-chaperones. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male sterility associated with arrested male meiosis and male germ cell apoptosis. Mice homozygous for a transgenic gene disruption exhibit male sterility and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,422,296 probably null Het
Atg7 T C 6: 114,702,053 V366A probably damaging Het
Cadm2 A T 16: 66,784,815 V192E probably damaging Het
Chil6 C T 3: 106,389,952 S291N possibly damaging Het
D7Ertd443e T C 7: 134,349,591 T118A probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah1 T A 14: 31,290,819 T1837S probably damaging Het
Ext1 A G 15: 53,088,143 V515A probably damaging Het
Fer1l4 T C 2: 156,048,189 E272G probably damaging Het
Fras1 T A 5: 96,677,377 H1475Q probably benign Het
Grid1 T C 14: 35,520,705 S672P possibly damaging Het
Gtpbp4 A G 13: 8,979,427 probably null Het
Irf5 T C 6: 29,531,146 S4P probably benign Het
Kif2b G T 11: 91,575,460 Q666K probably benign Het
Macc1 A T 12: 119,450,375 H762L probably benign Het
Map1s C T 8: 70,917,107 T941M probably damaging Het
Mrgprb1 T A 7: 48,447,775 I130F probably benign Het
Nbeal1 T G 1: 60,237,152 V684G possibly damaging Het
Ngly1 C T 14: 16,270,508 Q173* probably null Het
Plcb3 A T 19: 6,966,219 M104K probably benign Het
Plcg2 T A 8: 117,612,995 Y1048* probably null Het
Ptprf T C 4: 118,224,924 Y1039C probably damaging Het
Rab38 A G 7: 88,430,487 Y29C probably damaging Het
Rcan2 T A 17: 44,037,030 V210E probably damaging Het
Rptn A T 3: 93,396,701 Q447L probably benign Het
Scel G A 14: 103,602,206 R495K probably benign Het
Scn11a G T 9: 119,755,238 P1437Q probably damaging Het
Sim2 A G 16: 94,109,456 D239G probably damaging Het
Skap2 A G 6: 51,860,018 Y356H probably damaging Het
Skint11 A G 4: 114,194,601 T49A probably benign Het
Snx33 G A 9: 56,925,397 H463Y probably benign Het
Steap2 T C 5: 5,677,544 T264A possibly damaging Het
Stk40 T A 4: 126,135,059 V238E probably damaging Het
Sun2 T C 15: 79,734,127 D277G probably benign Het
Ttll9 T C 2: 152,990,100 probably null Het
Vmn1r54 G A 6: 90,269,365 C87Y probably benign Het
Other mutations in Hsp90aa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02056:Hsp90aa1 APN 12 110694015 unclassified probably benign
IGL02243:Hsp90aa1 APN 12 110695091 missense probably damaging 1.00
IGL02865:Hsp90aa1 APN 12 110693082 missense probably benign 0.11
IGL02965:Hsp90aa1 APN 12 110695679 start codon destroyed probably null 0.95
R0827:Hsp90aa1 UTSW 12 110692695 missense probably benign 0.38
R1331:Hsp90aa1 UTSW 12 110692820 missense probably damaging 1.00
R1498:Hsp90aa1 UTSW 12 110695688 splice site probably null
R2039:Hsp90aa1 UTSW 12 110693782 missense probably damaging 1.00
R2082:Hsp90aa1 UTSW 12 110692827 missense probably damaging 1.00
R2102:Hsp90aa1 UTSW 12 110694132 missense probably damaging 0.99
R2169:Hsp90aa1 UTSW 12 110692734 missense probably damaging 0.99
R2194:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R2194:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R2359:Hsp90aa1 UTSW 12 110694569 critical splice donor site probably null
R2364:Hsp90aa1 UTSW 12 110692753 missense probably damaging 0.99
R2393:Hsp90aa1 UTSW 12 110693406 missense probably damaging 1.00
R2398:Hsp90aa1 UTSW 12 110692321 missense possibly damaging 0.86
R2435:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R2435:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R2924:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R2924:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R2925:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R2925:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3176:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3176:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3177:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3177:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3276:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3276:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3277:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3277:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3615:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3615:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3616:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3616:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R4033:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R4033:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R4815:Hsp90aa1 UTSW 12 110695226 missense possibly damaging 0.45
R4932:Hsp90aa1 UTSW 12 110693717 missense probably damaging 1.00
R5117:Hsp90aa1 UTSW 12 110695264 missense possibly damaging 0.71
R6382:Hsp90aa1 UTSW 12 110695517 critical splice donor site probably null
R7024:Hsp90aa1 UTSW 12 110694112 missense possibly damaging 0.46
R7324:Hsp90aa1 UTSW 12 110695225 missense unknown
R7447:Hsp90aa1 UTSW 12 110692128 missense possibly damaging 0.94
R7526:Hsp90aa1 UTSW 12 110695294 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGACCAAACTGACTACGAGTG -3'
(R):5'- GAATGTCCAGCCTGTACCTAAGG -3'

Sequencing Primer
(F):5'- CTGACTACGAGTGATGTGTAACC -3'
(R):5'- TCCAGCCTGTACCTAAGGGAAAG -3'
Posted On2016-10-24