Incidental Mutation 'R5556:2310035C23Rik'
List |< first << previous [record 77 of 18487] next >> last >|
ID435362
Institutional Source Beutler Lab
Gene Symbol 2310035C23Rik
Ensembl Gene ENSMUSG00000026319
Gene NameRIKEN cDNA 2310035C23 gene
Synonyms
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location105663861-105755191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 105693167 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 456 (Q456K)
Ref Sequence ENSEMBL: ENSMUSP00000141162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039173] [ENSMUST00000086721] [ENSMUST00000186807] [ENSMUST00000190501]
Predicted Effect probably benign
Transcript: ENSMUST00000039173
AA Change: Q480K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039178
Gene: ENSMUSG00000026319
AA Change: Q480K

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
LisH 231 263 1.25e-3 SMART
coiled coil region 334 372 N/A INTRINSIC
SCOP:d1b3ua_ 532 1069 4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086721
AA Change: Q480K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083926
Gene: ENSMUSG00000026319
AA Change: Q480K

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
coiled coil region 197 232 N/A INTRINSIC
LisH 255 287 1.25e-3 SMART
coiled coil region 358 396 N/A INTRINSIC
SCOP:d1b3ua_ 556 1093 5e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185692
Predicted Effect probably benign
Transcript: ENSMUST00000186807
SMART Domains Protein: ENSMUSP00000140699
Gene: ENSMUSG00000026319

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
coiled coil region 197 232 N/A INTRINSIC
LisH 255 287 3.9e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190501
AA Change: Q456K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141162
Gene: ENSMUSG00000026319
AA Change: Q456K

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
LisH 231 263 1.25e-3 SMART
coiled coil region 334 372 N/A INTRINSIC
SCOP:d1b3ua_ 532 1069 4e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191293
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in 2310035C23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:2310035C23Rik APN 1 105696599 splice site probably benign
IGL02393:2310035C23Rik APN 1 105687368 missense probably damaging 1.00
IGL02655:2310035C23Rik APN 1 105678246 missense probably damaging 1.00
IGL02992:2310035C23Rik APN 1 105719464 missense possibly damaging 0.89
IGL03170:2310035C23Rik APN 1 105735955 missense probably damaging 0.99
IGL03050:2310035C23Rik UTSW 1 105726381 missense probably damaging 0.98
R0022:2310035C23Rik UTSW 1 105691902 splice site probably benign
R0399:2310035C23Rik UTSW 1 105750959 splice site probably benign
R1243:2310035C23Rik UTSW 1 105750364 missense probably damaging 1.00
R1563:2310035C23Rik UTSW 1 105719534 missense probably damaging 1.00
R1760:2310035C23Rik UTSW 1 105719444 splice site probably benign
R1894:2310035C23Rik UTSW 1 105664576 missense probably benign 0.12
R2036:2310035C23Rik UTSW 1 105743254 missense probably damaging 1.00
R2428:2310035C23Rik UTSW 1 105746126 missense possibly damaging 0.88
R2905:2310035C23Rik UTSW 1 105691994 missense probably benign 0.04
R3121:2310035C23Rik UTSW 1 105725799 missense probably benign 0.15
R3750:2310035C23Rik UTSW 1 105753577 missense probably damaging 1.00
R3886:2310035C23Rik UTSW 1 105692213 missense probably benign 0.14
R4284:2310035C23Rik UTSW 1 105721287 missense probably damaging 0.98
R4671:2310035C23Rik UTSW 1 105718859 missense probably benign 0.00
R4706:2310035C23Rik UTSW 1 105692279 missense probably benign 0.28
R4760:2310035C23Rik UTSW 1 105721305 missense probably benign 0.17
R4776:2310035C23Rik UTSW 1 105719535 nonsense probably null
R5031:2310035C23Rik UTSW 1 105664514 missense probably damaging 1.00
R5051:2310035C23Rik UTSW 1 105691986 missense possibly damaging 0.85
R5085:2310035C23Rik UTSW 1 105678180 missense probably damaging 0.99
R5104:2310035C23Rik UTSW 1 105731240 missense probably benign 0.45
R5187:2310035C23Rik UTSW 1 105718809 nonsense probably null
R5259:2310035C23Rik UTSW 1 105721376 missense probably benign 0.01
R5435:2310035C23Rik UTSW 1 105741250 intron probably benign
R5444:2310035C23Rik UTSW 1 105726384 missense possibly damaging 0.60
R5490:2310035C23Rik UTSW 1 105719501 missense probably damaging 0.99
R5513:2310035C23Rik UTSW 1 105750973 missense probably damaging 0.99
R5734:2310035C23Rik UTSW 1 105703883 intron probably benign
R5779:2310035C23Rik UTSW 1 105687347 missense probably damaging 1.00
R5822:2310035C23Rik UTSW 1 105718856 missense probably damaging 1.00
R5878:2310035C23Rik UTSW 1 105692960 missense probably benign
R6015:2310035C23Rik UTSW 1 105691958 missense probably damaging 1.00
R6051:2310035C23Rik UTSW 1 105721272 missense probably damaging 1.00
R6266:2310035C23Rik UTSW 1 105731282 critical splice donor site probably null
R6556:2310035C23Rik UTSW 1 105726440 missense probably damaging 1.00
R6571:2310035C23Rik UTSW 1 105692982 missense probably benign
R6612:2310035C23Rik UTSW 1 105692007 missense possibly damaging 0.72
R6852:2310035C23Rik UTSW 1 105753595 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCTGTAAATAGTTCAGACCAG -3'
(R):5'- TGGGCTTATGCACTTAACAAAGAC -3'

Sequencing Primer
(F):5'- CTTTCCCCAGGAAGGAAA -3'
(R):5'- TGCACTTAACAAAGACAGAACTTG -3'
Posted On2016-10-24