Incidental Mutation 'R5557:Abi2'
ID435423
Institutional Source Beutler Lab
Gene Symbol Abi2
Ensembl Gene ENSMUSG00000026782
Gene Nameabl-interactor 2
Synonyms8430425M24Rik
MMRRC Submission 043114-MU
Accession Numbers

Genbank: NM_001198570.1, NM_001198571.1, NM_198127.2; Ensembl: ENSMUST00000052332, ENSMUST00000087417

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5557 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location60409619-60481158 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 60438912 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052332] [ENSMUST00000185788] [ENSMUST00000186097] [ENSMUST00000187709] [ENSMUST00000188594] [ENSMUST00000188618] [ENSMUST00000189082] [ENSMUST00000189980] [ENSMUST00000190158]
Predicted Effect probably benign
Transcript: ENSMUST00000052332
SMART Domains Protein: ENSMUSP00000058754
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 168 1.1e-37 PFAM
low complexity region 236 262 N/A INTRINSIC
low complexity region 335 370 N/A INTRINSIC
SH3 387 442 5.55e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185788
SMART Domains Protein: ENSMUSP00000139483
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
Pfam:Abi_HHR 1 67 4.4e-25 PFAM
low complexity region 68 81 N/A INTRINSIC
low complexity region 83 115 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
low complexity region 249 284 N/A INTRINSIC
SH3 301 356 3.4e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186097
SMART Domains Protein: ENSMUSP00000139501
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 95 121 N/A INTRINSIC
low complexity region 125 143 N/A INTRINSIC
low complexity region 284 319 N/A INTRINSIC
SH3 336 391 3.4e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187400
Predicted Effect probably benign
Transcript: ENSMUST00000187709
SMART Domains Protein: ENSMUSP00000139867
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 165 1.8e-33 PFAM
low complexity region 166 179 N/A INTRINSIC
low complexity region 236 262 N/A INTRINSIC
low complexity region 364 399 N/A INTRINSIC
SH3 416 471 3.4e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188594
SMART Domains Protein: ENSMUSP00000140750
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 165 1.7e-33 PFAM
low complexity region 166 179 N/A INTRINSIC
low complexity region 181 213 N/A INTRINSIC
low complexity region 217 235 N/A INTRINSIC
low complexity region 347 382 N/A INTRINSIC
SH3 399 454 3.4e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188618
SMART Domains Protein: ENSMUSP00000140274
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 5.1e-37 PFAM
low complexity region 172 185 N/A INTRINSIC
low complexity region 242 268 N/A INTRINSIC
low complexity region 272 290 N/A INTRINSIC
low complexity region 402 437 N/A INTRINSIC
SH3 454 487 2.29e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189082
SMART Domains Protein: ENSMUSP00000140522
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
Pfam:Abi_HHR 38 115 5.8e-34 PFAM
low complexity region 116 129 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189649
Predicted Effect probably benign
Transcript: ENSMUST00000189980
SMART Domains Protein: ENSMUSP00000141068
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 5e-37 PFAM
low complexity region 172 185 N/A INTRINSIC
low complexity region 242 268 N/A INTRINSIC
low complexity region 369 404 N/A INTRINSIC
SH3 421 476 5.55e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190158
SMART Domains Protein: ENSMUSP00000139743
Gene: ENSMUSG00000026782

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
low complexity region 33 65 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
PDB:4N78|F 88 196 5e-62 PDB
low complexity region 226 261 N/A INTRINSIC
SH3 278 333 3.4e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191493
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Homozygous null mice display microphthalmia, abnormal lens development, abnormal corpus callosum, cerebral cortex, and hippocampus morphology, and impaired contextual conditioning. [provided by MGI curators]
Allele List at MGI

All alleles(30) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,717,501 F363I possibly damaging Het
Abcb1a T A 5: 8,714,949 N646K probably benign Het
Adamts13 T C 2: 26,973,639 S35P probably benign Het
B4galt3 A G 1: 171,272,519 probably null Het
Bag5 T C 12: 111,710,090 N433S probably benign Het
Birc7 T A 2: 180,932,979 V218D probably benign Het
Catsperg1 T G 7: 29,195,871 N332T possibly damaging Het
Ccdc191 A C 16: 43,908,613 T179P probably damaging Het
Col4a3 C T 1: 82,715,247 probably benign Het
Crlf1 A G 8: 70,498,667 I65M probably benign Het
Dennd4a T G 9: 64,904,227 D1376E probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dlg4 C T 11: 70,042,280 P504L probably damaging Het
Dopey2 A G 16: 93,763,931 T886A probably damaging Het
Dst T A 1: 34,282,586 V4394E probably damaging Het
Endov T C 11: 119,502,360 M112T possibly damaging Het
Eps8 T C 6: 137,479,096 M796V possibly damaging Het
Fam107b T A 2: 3,770,754 Y7* probably null Het
Farsb C T 1: 78,469,251 probably null Het
Fasn A G 11: 120,812,426 M1591T probably benign Het
Fbn2 C T 18: 58,115,659 A384T probably benign Het
Fnta T C 8: 25,999,536 D349G probably damaging Het
Glis3 G T 19: 28,264,009 H842N probably benign Het
Gm17067 G A 7: 42,708,521 P186S probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hk3 A T 13: 55,012,075 L362* probably null Het
Ing3 A G 6: 21,968,909 H130R possibly damaging Het
Inpp4b A T 8: 81,952,259 Q306L probably damaging Het
Kcnq2 T C 2: 181,134,897 K66E probably benign Het
Kif21b C A 1: 136,170,059 N1352K probably damaging Het
Lrig3 A T 10: 125,972,134 N84Y probably damaging Het
Mill2 T A 7: 18,855,959 Y55* probably null Het
Mmachc T C 4: 116,705,900 H86R probably damaging Het
Ncbp1 T C 4: 46,165,259 V524A probably benign Het
Olfr1116 A T 2: 87,269,392 T204S possibly damaging Het
Olfr1189 G A 2: 88,592,553 V250M probably damaging Het
Olfr1453 C A 19: 13,027,640 A230S probably benign Het
Olfr312 G A 11: 58,831,987 V278I probably benign Het
Olfr357 T A 2: 36,997,346 C179S probably damaging Het
Olfr832 T C 9: 18,945,170 I174T possibly damaging Het
Pigu G T 2: 155,278,629 Y404* probably null Het
Plaa A T 4: 94,584,007 probably null Het
Plcg2 A T 8: 117,586,557 I487F probably damaging Het
Plekhh2 T C 17: 84,560,152 I162T probably benign Het
Ptprz1 T A 6: 23,001,001 V1030D probably benign Het
Raver2 C A 4: 101,136,139 S505R probably benign Het
Samd7 A T 3: 30,756,620 Q262L probably benign Het
Scn9a T A 2: 66,547,103 N412Y probably damaging Het
Sytl1 C A 4: 133,259,356 R91M probably damaging Het
Tead3 A T 17: 28,336,270 probably benign Het
Tgm1 A G 14: 55,705,643 M580T probably benign Het
Themis A T 10: 28,781,886 Q150L possibly damaging Het
Tmem213 T C 6: 38,109,531 S41P possibly damaging Het
Tnks1bp1 T C 2: 85,063,800 V695A probably damaging Het
Trim23 A T 13: 104,187,509 T159S probably damaging Het
Trim66 T C 7: 109,483,737 Y166C probably benign Het
Troap A T 15: 99,075,794 T111S possibly damaging Het
Ttn T C 2: 76,890,390 probably null Het
Tub T G 7: 109,025,718 S180A probably damaging Het
Vcan A G 13: 89,703,112 V1243A possibly damaging Het
Zfp608 T C 18: 54,987,870 D215G possibly damaging Het
Zfp638 T A 6: 83,967,363 V1021E probably damaging Het
Zim1 T A 7: 6,677,711 I318F probably damaging Het
Other mutations in Abi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Abi2 APN 1 60447346 missense probably damaging 1.00
IGL01369:Abi2 APN 1 60437056 missense probably damaging 1.00
IGL02028:Abi2 APN 1 60434283 missense probably damaging 1.00
IGL02074:Abi2 APN 1 60447307 missense probably damaging 1.00
IGL02897:Abi2 APN 1 60448194 missense probably damaging 0.96
IGL02957:Abi2 APN 1 60470786 missense probably damaging 1.00
1mM(1):Abi2 UTSW 1 60437057 missense probably damaging 1.00
P0026:Abi2 UTSW 1 60453723 missense probably benign 0.42
R0062:Abi2 UTSW 1 60453725 missense probably benign 0.42
R0062:Abi2 UTSW 1 60453725 missense probably benign 0.42
R3946:Abi2 UTSW 1 60453754 missense probably damaging 1.00
R4793:Abi2 UTSW 1 60409804 start codon destroyed probably null 1.00
R5110:Abi2 UTSW 1 60450121 missense probably benign 0.00
R6037:Abi2 UTSW 1 60464579 missense probably damaging 1.00
R6037:Abi2 UTSW 1 60464579 missense probably damaging 1.00
R6368:Abi2 UTSW 1 60453651 missense possibly damaging 0.82
R6481:Abi2 UTSW 1 60438939 unclassified probably null
R7393:Abi2 UTSW 1 60434382 missense possibly damaging 0.92
R7460:Abi2 UTSW 1 60434307 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATCATCAACGAAACTTCTGTCC -3'
(R):5'- AGCATATTAGTTGGCCCTCC -3'

Sequencing Primer
(F):5'- GAAACTTCTGTCCATGACACATCTG -3'
(R):5'- TGGTACTGTTCTAGGCACAAAG -3'
Posted On2016-10-24