Incidental Mutation 'R5569:Fscn1'
ID435522
Institutional Source Beutler Lab
Gene Symbol Fscn1
Ensembl Gene ENSMUSG00000029581
Gene Namefascin actin-bundling protein 1
SynonymsFan1, fascin-1
MMRRC Submission 043126-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #R5569 (G1)
Quality Score136
Status Not validated
Chromosome5
Chromosomal Location142960343-142973185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142961044 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 199 (D199G)
Ref Sequence ENSEMBL: ENSMUSP00000031565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031565] [ENSMUST00000198017]
Predicted Effect probably benign
Transcript: ENSMUST00000031565
AA Change: D199G

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000031565
Gene: ENSMUSG00000029581
AA Change: D199G

DomainStartEndE-ValueType
Pfam:Fascin 20 134 1.9e-37 PFAM
Pfam:Fascin 142 256 4.1e-30 PFAM
Pfam:Fascin 268 378 1.3e-36 PFAM
Pfam:Fascin 391 493 9.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129306
SMART Domains Protein: ENSMUSP00000122862
Gene: ENSMUSG00000029581

DomainStartEndE-ValueType
Pfam:Fascin 16 126 1.1e-37 PFAM
Pfam:Fascin 139 241 8.3e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137552
SMART Domains Protein: ENSMUSP00000119590
Gene: ENSMUSG00000029581

DomainStartEndE-ValueType
Pfam:Fascin 1 100 1.6e-33 PFAM
Pfam:Fascin 113 167 1.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139131
SMART Domains Protein: ENSMUSP00000115116
Gene: ENSMUSG00000029581

DomainStartEndE-ValueType
Pfam:Fascin 1 100 1.1e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150622
SMART Domains Protein: ENSMUSP00000123347
Gene: ENSMUSG00000029581

DomainStartEndE-ValueType
Pfam:Fascin 1 100 3.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198017
SMART Domains Protein: ENSMUSP00000142509
Gene: ENSMUSG00000029581

DomainStartEndE-ValueType
Pfam:Fascin 20 74 2.3e-12 PFAM
Pfam:Fascin 107 217 7.3e-34 PFAM
Pfam:Fascin 230 332 1.5e-23 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired migration of mature dendritic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A G 5: 121,626,080 S929P probably damaging Het
Ackr3 A G 1: 90,214,841 T341A probably benign Het
Acox3 A G 5: 35,603,033 Y431C probably damaging Het
Adamtsl2 G A 2: 27,102,833 V653M probably damaging Het
Anks6 T C 4: 47,045,007 K300E probably damaging Het
Ap5z1 A T 5: 142,474,451 D495V probably damaging Het
Atm A T 9: 53,516,450 Y453* probably null Het
Atpaf2 A T 11: 60,416,880 W11R probably damaging Het
Capn1 T A 19: 6,013,660 T129S probably benign Het
Cdh17 A G 4: 11,816,990 I800M probably damaging Het
Cfap206 C T 4: 34,724,892 R69Q probably damaging Het
Cp T C 3: 19,978,877 Y623H probably damaging Het
Dcaf5 A T 12: 80,340,201 Y384N probably damaging Het
Dhx9 A T 1: 153,467,092 C555S possibly damaging Het
Dlg2 A G 7: 91,968,180 T317A probably benign Het
Dsp C T 13: 38,192,652 T1471I probably benign Het
Ebf1 A G 11: 44,992,401 M489V possibly damaging Het
Enpp3 T C 10: 24,778,821 D230G probably damaging Het
Eri3 T C 4: 117,649,356 M294T possibly damaging Het
Fat1 T A 8: 45,039,836 V3842E probably damaging Het
Fermt1 T A 2: 132,915,203 Y569F possibly damaging Het
Glce A G 9: 62,070,203 V133A probably benign Het
Gm10020 T C 15: 52,478,228 noncoding transcript Het
Gm16432 A T 1: 178,111,596 K678N possibly damaging Het
Gm5096 A C 18: 87,757,268 Y305S probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hk1 A G 10: 62,286,441 S520P probably benign Het
Ighv12-3 A G 12: 114,366,935 V7A probably benign Het
Ighv6-7 C A 12: 114,455,856 A43S probably damaging Het
Inf2 A G 12: 112,601,679 I222V possibly damaging Het
Kmo T A 1: 175,655,122 N337K probably benign Het
Mcf2l C T 8: 13,005,481 R611W probably damaging Het
Mipep A T 14: 60,802,934 H301L probably damaging Het
Mprip A T 11: 59,760,963 E1831V probably damaging Het
Mrgpra3 T C 7: 47,590,011 T56A probably benign Het
Mtmr14 G A 6: 113,240,285 V53I probably damaging Het
Mycbp2 A T 14: 103,135,243 W4056R probably damaging Het
Myl2 A T 5: 122,106,720 D151V possibly damaging Het
Myo5c A T 9: 75,273,510 D727V probably damaging Het
Olfr381 A T 11: 73,486,692 I44N probably damaging Het
Olfr466 A G 13: 65,152,979 T252A possibly damaging Het
Olfr504 T A 7: 108,565,565 M77L probably benign Het
Olfr693 A T 7: 106,678,483 M1K probably null Het
Olfr982 A G 9: 40,074,297 M1V probably null Het
Pabpc1l C T 2: 164,043,554 T409I probably benign Het
Pcgf1 C T 6: 83,079,705 R81* probably null Het
Pcgf2 A G 11: 97,692,367 probably null Het
Phf14 T A 6: 11,934,016 N292K probably damaging Het
Plin4 T C 17: 56,102,147 T1358A probably benign Het
Pomgnt1 T C 4: 116,155,967 S423P probably damaging Het
Pqlc3 T A 12: 16,995,628 I114F possibly damaging Het
Prep G A 10: 45,097,437 V214I probably benign Het
Ptger1 T C 8: 83,668,332 probably null Het
Pus7 C T 5: 23,748,834 G415D probably benign Het
Rbm44 C T 1: 91,168,738 P940S probably damaging Het
Ripor1 A T 8: 105,617,515 D427V probably damaging Het
Rp1 A G 1: 4,345,237 I1884T probably damaging Het
Serinc2 T C 4: 130,278,479 R7G probably benign Het
Serpina6 A C 12: 103,654,460 F10C possibly damaging Het
Skint5 T A 4: 113,688,706 probably null Het
Slc6a4 A T 11: 77,023,255 I544F possibly damaging Het
Spdye4b T C 5: 143,202,421 M223T probably benign Het
Tbc1d17 A T 7: 44,848,331 V39D probably damaging Het
Thbs3 T A 3: 89,219,463 Y295N probably damaging Het
Themis G A 10: 28,781,891 E152K possibly damaging Het
Tmem131 A T 1: 36,799,338 I1502N probably benign Het
Tmem43 T A 6: 91,477,354 M41K probably benign Het
Tmprss6 A C 15: 78,440,303 W771G probably damaging Het
Trp53tg5 T C 2: 164,471,336 T140A probably benign Het
Uchl1 A G 5: 66,686,873 E206G probably damaging Het
Vash2 A G 1: 190,960,291 V229A possibly damaging Het
Vmn1r192 C A 13: 22,187,214 A279S possibly damaging Het
Vmn1r32 T C 6: 66,553,172 R207G probably damaging Het
Vmn2r14 T A 5: 109,220,395 M244L probably benign Het
Vwa5b2 T A 16: 20,595,339 H236Q probably damaging Het
Zfp652 C T 11: 95,749,290 P14S probably benign Het
Zfp668 G A 7: 127,867,823 R194* probably null Het
Zgrf1 G T 3: 127,561,025 V98L probably benign Het
Other mutations in Fscn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02189:Fscn1 APN 5 142960620 missense possibly damaging 0.46
IGL02311:Fscn1 APN 5 142972010 missense probably benign 0.08
R0037:Fscn1 UTSW 5 142970694 splice site probably benign
R1163:Fscn1 UTSW 5 142960843 missense probably damaging 1.00
R1860:Fscn1 UTSW 5 142970063 critical splice donor site probably null
R4342:Fscn1 UTSW 5 142972021 missense probably damaging 1.00
R6248:Fscn1 UTSW 5 142961023 missense possibly damaging 0.94
R6517:Fscn1 UTSW 5 142971986 missense probably damaging 0.98
R6594:Fscn1 UTSW 5 142970028 missense probably benign 0.02
R6964:Fscn1 UTSW 5 142960660 missense probably damaging 1.00
R7000:Fscn1 UTSW 5 142960627 missense probably damaging 1.00
R7108:Fscn1 UTSW 5 142960515 missense probably damaging 1.00
R7165:Fscn1 UTSW 5 142972046 missense probably benign 0.13
R7233:Fscn1 UTSW 5 142970274 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TAACATCTACAGCGTTACCCG -3'
(R):5'- CTTTTGTGCACTGGGTCAGGAC -3'

Sequencing Primer
(F):5'- TTACCCGCAAGCGCTACG -3'
(R):5'- GGACACGTTCCTCTCGTTGG -3'
Posted On2016-10-24