Incidental Mutation 'R5569:Ebf1'
ID435548
Institutional Source Beutler Lab
Gene Symbol Ebf1
Ensembl Gene ENSMUSG00000057098
Gene Nameearly B cell factor 1
SynonymsOlf1, O/E-1, Olf-1
MMRRC Submission 043126-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R5569 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location44617317-45008091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44992401 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 489 (M489V)
Ref Sequence ENSEMBL: ENSMUSP00000099857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081265] [ENSMUST00000101326] [ENSMUST00000109268]
Predicted Effect probably benign
Transcript: ENSMUST00000081265
AA Change: M488V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000080020
Gene: ENSMUSG00000057098
AA Change: M488V

DomainStartEndE-ValueType
IPT 261 345 7.38e-8 SMART
HLH 346 395 5.4e-2 SMART
low complexity region 526 544 N/A INTRINSIC
low complexity region 564 575 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101326
AA Change: M489V

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099857
Gene: ENSMUSG00000057098
AA Change: M489V

DomainStartEndE-ValueType
Pfam:COE1_DBD 17 247 8e-150 PFAM
IPT 262 346 7.38e-8 SMART
HLH 347 396 5.4e-2 SMART
low complexity region 527 545 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109268
AA Change: M481V

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104891
Gene: ENSMUSG00000057098
AA Change: M481V

DomainStartEndE-ValueType
IPT 254 338 7.38e-8 SMART
HLH 339 388 5.4e-2 SMART
low complexity region 519 537 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit a reduced striatum due to excess apoptosis, altered facial branchiomotor neurone migration, and a block in B cell differentiation. Mutants are smaller than normal and many die prior to 4 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A G 5: 121,626,080 S929P probably damaging Het
Ackr3 A G 1: 90,214,841 T341A probably benign Het
Acox3 A G 5: 35,603,033 Y431C probably damaging Het
Adamtsl2 G A 2: 27,102,833 V653M probably damaging Het
Anks6 T C 4: 47,045,007 K300E probably damaging Het
Ap5z1 A T 5: 142,474,451 D495V probably damaging Het
Atm A T 9: 53,516,450 Y453* probably null Het
Atpaf2 A T 11: 60,416,880 W11R probably damaging Het
Capn1 T A 19: 6,013,660 T129S probably benign Het
Cdh17 A G 4: 11,816,990 I800M probably damaging Het
Cfap206 C T 4: 34,724,892 R69Q probably damaging Het
Cp T C 3: 19,978,877 Y623H probably damaging Het
Dcaf5 A T 12: 80,340,201 Y384N probably damaging Het
Dhx9 A T 1: 153,467,092 C555S possibly damaging Het
Dlg2 A G 7: 91,968,180 T317A probably benign Het
Dsp C T 13: 38,192,652 T1471I probably benign Het
Enpp3 T C 10: 24,778,821 D230G probably damaging Het
Eri3 T C 4: 117,649,356 M294T possibly damaging Het
Fat1 T A 8: 45,039,836 V3842E probably damaging Het
Fermt1 T A 2: 132,915,203 Y569F possibly damaging Het
Fscn1 A G 5: 142,961,044 D199G probably benign Het
Glce A G 9: 62,070,203 V133A probably benign Het
Gm10020 T C 15: 52,478,228 noncoding transcript Het
Gm16432 A T 1: 178,111,596 K678N possibly damaging Het
Gm5096 A C 18: 87,757,268 Y305S probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hk1 A G 10: 62,286,441 S520P probably benign Het
Ighv12-3 A G 12: 114,366,935 V7A probably benign Het
Ighv6-7 C A 12: 114,455,856 A43S probably damaging Het
Inf2 A G 12: 112,601,679 I222V possibly damaging Het
Kmo T A 1: 175,655,122 N337K probably benign Het
Mcf2l C T 8: 13,005,481 R611W probably damaging Het
Mipep A T 14: 60,802,934 H301L probably damaging Het
Mprip A T 11: 59,760,963 E1831V probably damaging Het
Mrgpra3 T C 7: 47,590,011 T56A probably benign Het
Mtmr14 G A 6: 113,240,285 V53I probably damaging Het
Mycbp2 A T 14: 103,135,243 W4056R probably damaging Het
Myl2 A T 5: 122,106,720 D151V possibly damaging Het
Myo5c A T 9: 75,273,510 D727V probably damaging Het
Olfr381 A T 11: 73,486,692 I44N probably damaging Het
Olfr466 A G 13: 65,152,979 T252A possibly damaging Het
Olfr504 T A 7: 108,565,565 M77L probably benign Het
Olfr693 A T 7: 106,678,483 M1K probably null Het
Olfr982 A G 9: 40,074,297 M1V probably null Het
Pabpc1l C T 2: 164,043,554 T409I probably benign Het
Pcgf1 C T 6: 83,079,705 R81* probably null Het
Pcgf2 A G 11: 97,692,367 probably null Het
Phf14 T A 6: 11,934,016 N292K probably damaging Het
Plin4 T C 17: 56,102,147 T1358A probably benign Het
Pomgnt1 T C 4: 116,155,967 S423P probably damaging Het
Pqlc3 T A 12: 16,995,628 I114F possibly damaging Het
Prep G A 10: 45,097,437 V214I probably benign Het
Ptger1 T C 8: 83,668,332 probably null Het
Pus7 C T 5: 23,748,834 G415D probably benign Het
Rbm44 C T 1: 91,168,738 P940S probably damaging Het
Ripor1 A T 8: 105,617,515 D427V probably damaging Het
Rp1 A G 1: 4,345,237 I1884T probably damaging Het
Serinc2 T C 4: 130,278,479 R7G probably benign Het
Serpina6 A C 12: 103,654,460 F10C possibly damaging Het
Skint5 T A 4: 113,688,706 probably null Het
Slc6a4 A T 11: 77,023,255 I544F possibly damaging Het
Spdye4b T C 5: 143,202,421 M223T probably benign Het
Tbc1d17 A T 7: 44,848,331 V39D probably damaging Het
Thbs3 T A 3: 89,219,463 Y295N probably damaging Het
Themis G A 10: 28,781,891 E152K possibly damaging Het
Tmem131 A T 1: 36,799,338 I1502N probably benign Het
Tmem43 T A 6: 91,477,354 M41K probably benign Het
Tmprss6 A C 15: 78,440,303 W771G probably damaging Het
Trp53tg5 T C 2: 164,471,336 T140A probably benign Het
Uchl1 A G 5: 66,686,873 E206G probably damaging Het
Vash2 A G 1: 190,960,291 V229A possibly damaging Het
Vmn1r192 C A 13: 22,187,214 A279S possibly damaging Het
Vmn1r32 T C 6: 66,553,172 R207G probably damaging Het
Vmn2r14 T A 5: 109,220,395 M244L probably benign Het
Vwa5b2 T A 16: 20,595,339 H236Q probably damaging Het
Zfp652 C T 11: 95,749,290 P14S probably benign Het
Zfp668 G A 7: 127,867,823 R194* probably null Het
Zgrf1 G T 3: 127,561,025 V98L probably benign Het
Other mutations in Ebf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Ebf1 APN 11 44869100 missense probably damaging 1.00
IGL02228:Ebf1 APN 11 44972912 missense probably damaging 1.00
IGL02430:Ebf1 APN 11 44924576 critical splice donor site probably null
Befuddled UTSW 11 44632775 missense probably damaging 0.98
Catastrophic UTSW 11 44883885 missense probably damaging 1.00
Crater_lake UTSW 11 44972908 nonsense probably null
ebby UTSW 11 44883814 missense probably damaging 1.00
oregano UTSW 11 44869169 missense probably damaging 1.00
Oregano2 UTSW 11 44990504 splice site probably null
R0102:Ebf1 UTSW 11 44991455 missense probably benign 0.02
R0102:Ebf1 UTSW 11 44991455 missense probably benign 0.02
R0141:Ebf1 UTSW 11 44908000 missense probably damaging 1.00
R0230:Ebf1 UTSW 11 44996122 missense probably damaging 1.00
R0243:Ebf1 UTSW 11 44869088 splice site probably benign
R0268:Ebf1 UTSW 11 44643413 missense probably damaging 0.96
R0414:Ebf1 UTSW 11 44924470 nonsense probably null
R0648:Ebf1 UTSW 11 44991510 missense probably damaging 0.99
R0765:Ebf1 UTSW 11 44869160 missense probably damaging 0.97
R1055:Ebf1 UTSW 11 44632775 missense probably damaging 0.98
R1432:Ebf1 UTSW 11 45004706 splice site probably benign
R1713:Ebf1 UTSW 11 44924566 missense probably damaging 1.00
R1749:Ebf1 UTSW 11 44908008 missense possibly damaging 0.68
R1989:Ebf1 UTSW 11 44621966 missense probably damaging 0.97
R2405:Ebf1 UTSW 11 44991522 missense probably damaging 0.98
R3110:Ebf1 UTSW 11 44643398 splice site probably benign
R4538:Ebf1 UTSW 11 44907995 missense probably benign 0.07
R4666:Ebf1 UTSW 11 44991557 missense probably damaging 0.99
R4855:Ebf1 UTSW 11 44972908 nonsense probably null
R4904:Ebf1 UTSW 11 44869169 missense probably damaging 1.00
R5137:Ebf1 UTSW 11 44991468 missense probably damaging 1.00
R5849:Ebf1 UTSW 11 44990504 splice site probably null
R5940:Ebf1 UTSW 11 44621221 missense probably damaging 1.00
R5989:Ebf1 UTSW 11 44996171 missense probably damaging 1.00
R6170:Ebf1 UTSW 11 44883885 missense probably damaging 1.00
R6512:Ebf1 UTSW 11 44992341 missense probably damaging 1.00
R6747:Ebf1 UTSW 11 44883814 missense probably damaging 1.00
R7031:Ebf1 UTSW 11 44621968 missense possibly damaging 0.95
R7042:Ebf1 UTSW 11 44991511 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAGATGTTCCTCCCTTACAC -3'
(R):5'- TCTCTGCTAGAGGGGATGGTAC -3'

Sequencing Primer
(F):5'- CCCCAGGTCTCCCACAGATG -3'
(R):5'- CCCAAGTTGAGGGTTGCAG -3'
Posted On2016-10-24