Incidental Mutation 'R5569:Tmprss6'
ID435569
Institutional Source Beutler Lab
Gene Symbol Tmprss6
Ensembl Gene ENSMUSG00000016942
Gene Nametransmembrane serine protease 6
Synonymsmatriptase-2, 1300008A22Rik
MMRRC Submission 043126-MU
Accession Numbers

ENSMUST00000017086; MGI: 1919003

Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R5569 (G1)
Quality Score210
Status Not validated
Chromosome15
Chromosomal Location78439667-78468634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 78440303 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 771 (W771G)
Ref Sequence ENSEMBL: ENSMUSP00000155401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017086] [ENSMUST00000089414] [ENSMUST00000159771] [ENSMUST00000162321] [ENSMUST00000162517] [ENSMUST00000166142] [ENSMUST00000229124] [ENSMUST00000229290] [ENSMUST00000229516] [ENSMUST00000229622] [ENSMUST00000230020] [ENSMUST00000230159] [ENSMUST00000230226]
Predicted Effect probably damaging
Transcript: ENSMUST00000017086
AA Change: W783G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017086
Gene: ENSMUSG00000016942
AA Change: W783G

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Pfam:SEA 88 191 3.2e-13 PFAM
CUB 341 452 3.82e-2 SMART
LDLa 457 489 1.33e-2 SMART
LDLa 490 527 2.31e-9 SMART
LDLa 530 568 1.07e-4 SMART
Tryp_SPc 576 806 3.75e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089414
SMART Domains Protein: ENSMUSP00000086835
Gene: ENSMUSG00000033287

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
BTB 31 132 1.76e-16 SMART
coiled coil region 208 244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159771
SMART Domains Protein: ENSMUSP00000125574
Gene: ENSMUSG00000033287

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
BTB 24 125 1.76e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160916
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161016
Predicted Effect probably benign
Transcript: ENSMUST00000162321
SMART Domains Protein: ENSMUSP00000125680
Gene: ENSMUSG00000033287

DomainStartEndE-ValueType
BTB 3 86 9.93e-2 SMART
low complexity region 168 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162517
SMART Domains Protein: ENSMUSP00000124290
Gene: ENSMUSG00000033287

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
BTB 31 132 1.76e-16 SMART
low complexity region 227 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162605
Predicted Effect probably benign
Transcript: ENSMUST00000162808
SMART Domains Protein: ENSMUSP00000125421
Gene: ENSMUSG00000033287

DomainStartEndE-ValueType
SCOP:d3kvt__ 2 36 3e-8 SMART
Blast:BTB 2 98 6e-30 BLAST
PDB:3DRY|E 2 127 4e-69 PDB
low complexity region 130 157 N/A INTRINSIC
low complexity region 160 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166142
SMART Domains Protein: ENSMUSP00000133210
Gene: ENSMUSG00000033287

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
BTB 31 132 1.76e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229124
Predicted Effect probably benign
Transcript: ENSMUST00000229290
Predicted Effect probably benign
Transcript: ENSMUST00000229516
Predicted Effect probably benign
Transcript: ENSMUST00000229622
Predicted Effect probably benign
Transcript: ENSMUST00000230020
Predicted Effect probably benign
Transcript: ENSMUST00000230159
Predicted Effect probably damaging
Transcript: ENSMUST00000230226
AA Change: W771G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230473
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II transmembrane serine proteinase that is found attached to the cell surface. The encoded protein may be involved in matrix remodeling processes in the liver. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygosity for an inactivating mutation of this gene results in hair loss over the entire body except the face, microcytic anemia and female infertility, all reversible by dietary iron supplementation. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(6) Gene trapped(2) Chemically induced(3)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A G 5: 121,626,080 S929P probably damaging Het
Ackr3 A G 1: 90,214,841 T341A probably benign Het
Acox3 A G 5: 35,603,033 Y431C probably damaging Het
Adamtsl2 G A 2: 27,102,833 V653M probably damaging Het
Anks6 T C 4: 47,045,007 K300E probably damaging Het
Ap5z1 A T 5: 142,474,451 D495V probably damaging Het
Atm A T 9: 53,516,450 Y453* probably null Het
Atpaf2 A T 11: 60,416,880 W11R probably damaging Het
Capn1 T A 19: 6,013,660 T129S probably benign Het
Cdh17 A G 4: 11,816,990 I800M probably damaging Het
Cfap206 C T 4: 34,724,892 R69Q probably damaging Het
Cp T C 3: 19,978,877 Y623H probably damaging Het
Dcaf5 A T 12: 80,340,201 Y384N probably damaging Het
Dhx9 A T 1: 153,467,092 C555S possibly damaging Het
Dlg2 A G 7: 91,968,180 T317A probably benign Het
Dsp C T 13: 38,192,652 T1471I probably benign Het
Ebf1 A G 11: 44,992,401 M489V possibly damaging Het
Enpp3 T C 10: 24,778,821 D230G probably damaging Het
Eri3 T C 4: 117,649,356 M294T possibly damaging Het
Fat1 T A 8: 45,039,836 V3842E probably damaging Het
Fermt1 T A 2: 132,915,203 Y569F possibly damaging Het
Fscn1 A G 5: 142,961,044 D199G probably benign Het
Glce A G 9: 62,070,203 V133A probably benign Het
Gm10020 T C 15: 52,478,228 noncoding transcript Het
Gm16432 A T 1: 178,111,596 K678N possibly damaging Het
Gm5096 A C 18: 87,757,268 Y305S probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hk1 A G 10: 62,286,441 S520P probably benign Het
Ighv12-3 A G 12: 114,366,935 V7A probably benign Het
Ighv6-7 C A 12: 114,455,856 A43S probably damaging Het
Inf2 A G 12: 112,601,679 I222V possibly damaging Het
Kmo T A 1: 175,655,122 N337K probably benign Het
Mcf2l C T 8: 13,005,481 R611W probably damaging Het
Mipep A T 14: 60,802,934 H301L probably damaging Het
Mprip A T 11: 59,760,963 E1831V probably damaging Het
Mrgpra3 T C 7: 47,590,011 T56A probably benign Het
Mtmr14 G A 6: 113,240,285 V53I probably damaging Het
Mycbp2 A T 14: 103,135,243 W4056R probably damaging Het
Myl2 A T 5: 122,106,720 D151V possibly damaging Het
Myo5c A T 9: 75,273,510 D727V probably damaging Het
Olfr381 A T 11: 73,486,692 I44N probably damaging Het
Olfr466 A G 13: 65,152,979 T252A possibly damaging Het
Olfr504 T A 7: 108,565,565 M77L probably benign Het
Olfr693 A T 7: 106,678,483 M1K probably null Het
Olfr982 A G 9: 40,074,297 M1V probably null Het
Pabpc1l C T 2: 164,043,554 T409I probably benign Het
Pcgf1 C T 6: 83,079,705 R81* probably null Het
Pcgf2 A G 11: 97,692,367 probably null Het
Phf14 T A 6: 11,934,016 N292K probably damaging Het
Plin4 T C 17: 56,102,147 T1358A probably benign Het
Pomgnt1 T C 4: 116,155,967 S423P probably damaging Het
Pqlc3 T A 12: 16,995,628 I114F possibly damaging Het
Prep G A 10: 45,097,437 V214I probably benign Het
Ptger1 T C 8: 83,668,332 probably null Het
Pus7 C T 5: 23,748,834 G415D probably benign Het
Rbm44 C T 1: 91,168,738 P940S probably damaging Het
Ripor1 A T 8: 105,617,515 D427V probably damaging Het
Rp1 A G 1: 4,345,237 I1884T probably damaging Het
Serinc2 T C 4: 130,278,479 R7G probably benign Het
Serpina6 A C 12: 103,654,460 F10C possibly damaging Het
Skint5 T A 4: 113,688,706 probably null Het
Slc6a4 A T 11: 77,023,255 I544F possibly damaging Het
Spdye4b T C 5: 143,202,421 M223T probably benign Het
Tbc1d17 A T 7: 44,848,331 V39D probably damaging Het
Thbs3 T A 3: 89,219,463 Y295N probably damaging Het
Themis G A 10: 28,781,891 E152K possibly damaging Het
Tmem131 A T 1: 36,799,338 I1502N probably benign Het
Tmem43 T A 6: 91,477,354 M41K probably benign Het
Trp53tg5 T C 2: 164,471,336 T140A probably benign Het
Uchl1 A G 5: 66,686,873 E206G probably damaging Het
Vash2 A G 1: 190,960,291 V229A possibly damaging Het
Vmn1r192 C A 13: 22,187,214 A279S possibly damaging Het
Vmn1r32 T C 6: 66,553,172 R207G probably damaging Het
Vmn2r14 T A 5: 109,220,395 M244L probably benign Het
Vwa5b2 T A 16: 20,595,339 H236Q probably damaging Het
Zfp652 C T 11: 95,749,290 P14S probably benign Het
Zfp668 G A 7: 127,867,823 R194* probably null Het
Zgrf1 G T 3: 127,561,025 V98L probably benign Het
Other mutations in Tmprss6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Tmprss6 APN 15 78442434 missense probably null 1.00
IGL02474:Tmprss6 APN 15 78442336 missense probably damaging 0.99
cubone UTSW 15 78446657 splice site probably null
ekans UTSW 15 78459427 splice site probably null
mask UTSW 15 78464455 intron probably benign
masquerade UTSW 15 78468000 intron probably benign
zorro UTSW 15 78464552 intron probably benign
PIT1430001:Tmprss6 UTSW 15 78440627 missense probably damaging 1.00
R0285:Tmprss6 UTSW 15 78452868 missense probably damaging 0.99
R1857:Tmprss6 UTSW 15 78452552 missense probably damaging 1.00
R2432:Tmprss6 UTSW 15 78465104 splice site probably benign
R4192:Tmprss6 UTSW 15 78446657 splice site probably null
R4226:Tmprss6 UTSW 15 78446699 missense probably damaging 1.00
R4227:Tmprss6 UTSW 15 78446699 missense probably damaging 1.00
R4334:Tmprss6 UTSW 15 78459427 splice site probably null
R4344:Tmprss6 UTSW 15 78459427 splice site probably null
R4446:Tmprss6 UTSW 15 78452839 missense probably damaging 1.00
R4508:Tmprss6 UTSW 15 78459778 missense probably damaging 1.00
R4643:Tmprss6 UTSW 15 78445356 missense probably damaging 0.98
R4743:Tmprss6 UTSW 15 78443710 missense probably damaging 0.99
R4836:Tmprss6 UTSW 15 78445388 missense probably damaging 1.00
R4859:Tmprss6 UTSW 15 78446677 missense probably damaging 0.99
R4869:Tmprss6 UTSW 15 78443680 unclassified probably null
R5197:Tmprss6 UTSW 15 78454189 missense probably damaging 1.00
R5212:Tmprss6 UTSW 15 78446260 missense probably damaging 0.99
R5225:Tmprss6 UTSW 15 78452507 missense probably damaging 0.97
R5572:Tmprss6 UTSW 15 78442422 missense probably damaging 1.00
R5669:Tmprss6 UTSW 15 78454956 missense possibly damaging 0.86
R5947:Tmprss6 UTSW 15 78452522 missense probably damaging 1.00
R6800:Tmprss6 UTSW 15 78440257 missense probably damaging 1.00
R6941:Tmprss6 UTSW 15 78446777 missense probably damaging 1.00
R6965:Tmprss6 UTSW 15 78444128 missense probably damaging 1.00
R7334:Tmprss6 UTSW 15 78443817 missense unknown
R7338:Tmprss6 UTSW 15 78459819 missense probably damaging 1.00
X0025:Tmprss6 UTSW 15 78455095 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GCCCCAGAATACTTGTGTCCTG -3'
(R):5'- TAACTAGCTATGGGGTGTGTCC -3'

Sequencing Primer
(F):5'- CAGAATACTTGTGTCCTGGCTGG -3'
(R):5'- TCCCACTTTACAGATGGGGAG -3'
Posted On2016-10-24