Incidental Mutation 'R5570:Rpl31'
ID435580
Institutional Source Beutler Lab
Gene Symbol Rpl31
Ensembl Gene ENSMUSG00000073702
Gene Nameribosomal protein L31
Synonyms
MMRRC Submission 043127-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5570 (G1)
Quality Score202
Status Not validated
Chromosome1
Chromosomal Location39367842-39371911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39370027 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 41 (R41C)
Ref Sequence ENSEMBL: ENSMUSP00000141808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054462] [ENSMUST00000086535] [ENSMUST00000178079] [ENSMUST00000179954] [ENSMUST00000192531] [ENSMUST00000193823] [ENSMUST00000194746] [ENSMUST00000195123]
Predicted Effect probably benign
Transcript: ENSMUST00000054462
SMART Domains Protein: ENSMUSP00000049967
Gene: ENSMUSG00000003134

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
GRAM 145 212 3.6e-20 SMART
GRAM 285 353 2.77e-21 SMART
TBC 501 714 4.51e-54 SMART
Blast:TBC 726 923 1e-120 BLAST
coiled coil region 960 991 N/A INTRINSIC
low complexity region 1030 1045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086535
AA Change: R41C

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000083722
Gene: ENSMUSG00000073702
AA Change: R41C

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 101 3.1e-43 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178079
AA Change: R41C

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000136354
Gene: ENSMUSG00000073702
AA Change: R41C

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 101 3.1e-43 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179954
AA Change: R41C

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000137631
Gene: ENSMUSG00000073702
AA Change: R41C

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 101 3.1e-43 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191855
Predicted Effect probably benign
Transcript: ENSMUST00000192099
Predicted Effect probably benign
Transcript: ENSMUST00000192531
SMART Domains Protein: ENSMUSP00000142143
Gene: ENSMUSG00000003134

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
low complexity region 80 98 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193823
SMART Domains Protein: ENSMUSP00000141750
Gene: ENSMUSG00000003134

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
GRAM 145 212 1.2e-22 SMART
GRAM 285 353 9.6e-24 SMART
TBC 501 714 2.2e-56 SMART
Blast:TBC 726 923 1e-120 BLAST
coiled coil region 960 990 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194746
AA Change: R41C

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000141808
Gene: ENSMUSG00000073702
AA Change: R41C

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 101 3.1e-40 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195123
AA Change: R41C

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000142039
Gene: ENSMUSG00000073702
AA Change: R41C

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 83 7.9e-29 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L31E family of ribosomal proteins. It is located in the cytoplasm. Higher levels of expression of this gene in familial adenomatous polyps compared to matched normal tissues have been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Carriers of dominant spontaneous mutations have a shortened, kinked tail with variable expessivity in the tail length and number of kinks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrv1 C A 9: 36,694,281 S41R probably damaging Het
Aqr G A 2: 114,148,970 T328M probably damaging Het
Arhgap26 C A 18: 39,099,618 D99E probably damaging Het
Boc G A 16: 44,492,824 T559I probably damaging Het
Cadps A T 14: 12,473,497 I876N possibly damaging Het
Cep72 T C 13: 74,040,141 Q211R probably benign Het
Clmp T C 9: 40,772,530 probably null Het
Coq6 T A 12: 84,368,639 D145E probably benign Het
Crym T C 7: 120,201,893 E11G probably benign Het
Defb36 T A 2: 152,612,583 V54E probably damaging Het
Dlg5 C A 14: 24,192,913 E55* probably null Het
Dock2 G T 11: 34,727,406 R128S probably damaging Het
E330034G19Rik A G 14: 24,296,824 K60E possibly damaging Het
Eps8l2 G A 7: 141,355,007 R76Q possibly damaging Het
Espn T C 4: 152,123,780 E460G probably damaging Het
Fbxl18 A G 5: 142,895,267 probably benign Het
Fgd5 T C 6: 91,988,687 S476P probably damaging Het
Gsto1 T C 19: 47,857,899 W62R probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gxylt1 A G 15: 93,254,299 probably null Het
Hs6st1 C T 1: 36,103,638 P218L probably benign Het
Kif5c A G 2: 49,730,199 D226G possibly damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Lpxn T A 19: 12,832,659 M265K possibly damaging Het
Map3k9 A G 12: 81,732,024 L505P possibly damaging Het
Mcm3ap C T 10: 76,481,096 R645W possibly damaging Het
Msr1 T C 8: 39,611,719 I305V probably benign Het
Muc4 A G 16: 32,777,692 E3237G possibly damaging Het
Necap1 T C 6: 122,881,512 F105L probably damaging Het
Nploc4 C T 11: 120,384,614 V499M probably benign Het
Nup93 T C 8: 94,314,670 V812A probably damaging Het
Olfr1012 G A 2: 85,759,650 S242F probably damaging Het
Olfr1328 T A 4: 118,934,066 I259F possibly damaging Het
Olfr49 A G 14: 54,282,368 F176L probably damaging Het
Parn G A 16: 13,665,930 P50L probably damaging Het
Pcdhb7 T C 18: 37,344,171 C787R probably benign Het
Pdk2 A T 11: 95,030,000 I175N probably damaging Het
Pelo T C 13: 115,089,616 I102V probably benign Het
Phf12 A G 11: 78,018,111 D339G possibly damaging Het
Phlpp1 A T 1: 106,173,432 I477F probably benign Het
Pigt T A 2: 164,501,562 Y319* probably null Het
Pmpca A G 2: 26,390,541 E133G probably damaging Het
Ptgs2 A G 1: 150,104,108 I321M probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Qsox2 A G 2: 26,225,218 M1T probably null Het
Rara C G 11: 98,972,652 R382G probably damaging Het
Rbbp6 A G 7: 123,001,834 probably benign Het
Rev3l T C 10: 39,852,075 probably null Het
Robo3 T A 9: 37,425,275 Y399F possibly damaging Het
Skint3 A G 4: 112,235,798 M20V probably benign Het
Slc17a6 A G 7: 51,658,756 D276G probably benign Het
Sult3a2 A T 10: 33,778,272 V128D probably damaging Het
Syt3 T A 7: 44,390,619 V92E possibly damaging Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Utp14b G A 1: 78,665,401 D339N probably damaging Het
Vars T C 17: 35,016,238 F1259L probably benign Het
Vmn1r115 A C 7: 20,844,630 V119G possibly damaging Het
Zc3h12a C T 4: 125,120,373 R293H probably damaging Het
Zfp638 A T 6: 83,979,188 E1592D probably damaging Het
Other mutations in Rpl31
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4838:Rpl31 UTSW 1 39370967 missense probably benign 0.03
R5566:Rpl31 UTSW 1 39370027 missense probably benign 0.05
R5567:Rpl31 UTSW 1 39370027 missense probably benign 0.05
R5580:Rpl31 UTSW 1 39370027 missense probably benign 0.05
R5644:Rpl31 UTSW 1 39370027 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TACTCTGGGAAAGTGAGCGG -3'
(R):5'- CTGCTAACTGAACTCTCAAATGTG -3'

Sequencing Primer
(F):5'- CGGGACATCTTGAACTATAGGATGC -3'
(R):5'- CTGAACTCTCAAATGTGACACAC -3'
Posted On2016-10-24