Incidental Mutation 'R5570:Olfr1328'
ID435600
Institutional Source Beutler Lab
Gene Symbol Olfr1328
Ensembl Gene ENSMUSG00000111259
Gene Nameolfactory receptor 1328
SynonymsOlfr1519, MOR259-1, MOR259-13, MOR259-1, GA_x6K02T2QD9B-18602750-18603691
MMRRC Submission 043127-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5570 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118930071-118938612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118934066 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 259 (I259F)
Ref Sequence ENSEMBL: ENSMUSP00000080626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081960] [ENSMUST00000215312]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081960
AA Change: I259F

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080626
Gene: ENSMUSG00000111259
AA Change: I259F

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.1e-53 PFAM
Pfam:7TM_GPCR_Srsx 36 306 9.1e-8 PFAM
Pfam:7tm_1 42 291 1.7e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215312
AA Change: I261F

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrv1 C A 9: 36,694,281 S41R probably damaging Het
Aqr G A 2: 114,148,970 T328M probably damaging Het
Arhgap26 C A 18: 39,099,618 D99E probably damaging Het
Boc G A 16: 44,492,824 T559I probably damaging Het
Cadps A T 14: 12,473,497 I876N possibly damaging Het
Cep72 T C 13: 74,040,141 Q211R probably benign Het
Clmp T C 9: 40,772,530 probably null Het
Coq6 T A 12: 84,368,639 D145E probably benign Het
Crym T C 7: 120,201,893 E11G probably benign Het
Defb36 T A 2: 152,612,583 V54E probably damaging Het
Dlg5 C A 14: 24,192,913 E55* probably null Het
Dock2 G T 11: 34,727,406 R128S probably damaging Het
E330034G19Rik A G 14: 24,296,824 K60E possibly damaging Het
Eps8l2 G A 7: 141,355,007 R76Q possibly damaging Het
Espn T C 4: 152,123,780 E460G probably damaging Het
Fbxl18 A G 5: 142,895,267 probably benign Het
Fgd5 T C 6: 91,988,687 S476P probably damaging Het
Gsto1 T C 19: 47,857,899 W62R probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gxylt1 A G 15: 93,254,299 probably null Het
Hs6st1 C T 1: 36,103,638 P218L probably benign Het
Kif5c A G 2: 49,730,199 D226G possibly damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Lpxn T A 19: 12,832,659 M265K possibly damaging Het
Map3k9 A G 12: 81,732,024 L505P possibly damaging Het
Mcm3ap C T 10: 76,481,096 R645W possibly damaging Het
Msr1 T C 8: 39,611,719 I305V probably benign Het
Muc4 A G 16: 32,777,692 E3237G possibly damaging Het
Necap1 T C 6: 122,881,512 F105L probably damaging Het
Nploc4 C T 11: 120,384,614 V499M probably benign Het
Nup93 T C 8: 94,314,670 V812A probably damaging Het
Olfr1012 G A 2: 85,759,650 S242F probably damaging Het
Olfr49 A G 14: 54,282,368 F176L probably damaging Het
Parn G A 16: 13,665,930 P50L probably damaging Het
Pcdhb7 T C 18: 37,344,171 C787R probably benign Het
Pdk2 A T 11: 95,030,000 I175N probably damaging Het
Pelo T C 13: 115,089,616 I102V probably benign Het
Phf12 A G 11: 78,018,111 D339G possibly damaging Het
Phlpp1 A T 1: 106,173,432 I477F probably benign Het
Pigt T A 2: 164,501,562 Y319* probably null Het
Pmpca A G 2: 26,390,541 E133G probably damaging Het
Ptgs2 A G 1: 150,104,108 I321M probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Qsox2 A G 2: 26,225,218 M1T probably null Het
Rara C G 11: 98,972,652 R382G probably damaging Het
Rbbp6 A G 7: 123,001,834 probably benign Het
Rev3l T C 10: 39,852,075 probably null Het
Robo3 T A 9: 37,425,275 Y399F possibly damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Skint3 A G 4: 112,235,798 M20V probably benign Het
Slc17a6 A G 7: 51,658,756 D276G probably benign Het
Sult3a2 A T 10: 33,778,272 V128D probably damaging Het
Syt3 T A 7: 44,390,619 V92E possibly damaging Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Utp14b G A 1: 78,665,401 D339N probably damaging Het
Vars T C 17: 35,016,238 F1259L probably benign Het
Vmn1r115 A C 7: 20,844,630 V119G possibly damaging Het
Zc3h12a C T 4: 125,120,373 R293H probably damaging Het
Zfp638 A T 6: 83,979,188 E1592D probably damaging Het
Other mutations in Olfr1328
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02491:Olfr1328 APN 4 118934161 missense probably damaging 1.00
IGL02685:Olfr1328 APN 4 118933937 missense possibly damaging 0.61
IGL02886:Olfr1328 APN 4 118934830 missense probably benign
IGL02899:Olfr1328 APN 4 118934662 missense probably damaging 1.00
IGL02957:Olfr1328 APN 4 118934119 missense probably damaging 1.00
PIT4453001:Olfr1328 UTSW 4 118934626 missense probably benign
R0211:Olfr1328 UTSW 4 118934270 missense probably benign 0.00
R0211:Olfr1328 UTSW 4 118934270 missense probably benign 0.00
R1158:Olfr1328 UTSW 4 118934417 missense probably damaging 1.00
R1450:Olfr1328 UTSW 4 118934510 missense probably benign 0.01
R1682:Olfr1328 UTSW 4 118934581 missense probably damaging 1.00
R1978:Olfr1328 UTSW 4 118934184 nonsense probably null
R2363:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R2364:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R2365:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R2507:Olfr1328 UTSW 4 118933925 missense probably benign
R2912:Olfr1328 UTSW 4 118934701 missense probably benign 0.28
R3937:Olfr1328 UTSW 4 118934683 missense probably damaging 1.00
R4058:Olfr1328 UTSW 4 118934683 missense probably damaging 1.00
R4089:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R4090:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R4419:Olfr1328 UTSW 4 118934389 missense possibly damaging 0.56
R4717:Olfr1328 UTSW 4 118934429 missense probably benign 0.45
R5591:Olfr1328 UTSW 4 118934461 missense probably damaging 1.00
R6149:Olfr1328 UTSW 4 118934431 missense probably damaging 1.00
R7202:Olfr1328 UTSW 4 118934018 missense probably benign
R7214:Olfr1328 UTSW 4 118933949 missense possibly damaging 0.88
R7391:Olfr1328 UTSW 4 118934001 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TCACTGGTCCAGCCTACTATG -3'
(R):5'- GAAGGTCCTTCAGTGCGTAG -3'

Sequencing Primer
(F):5'- TGTCCCATCACCTTGAGAAATG -3'
(R):5'- GATACCCACCTCATTGAGATGGTG -3'
Posted On2016-10-24