Incidental Mutation 'R5570:Phf12'
ID435623
Institutional Source Beutler Lab
Gene Symbol Phf12
Ensembl Gene ENSMUSG00000037791
Gene NamePHD finger protein 12
Synonyms2410142K10Rik, PF1
MMRRC Submission 043127-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.634) question?
Stock #R5570 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location77982754-78030539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78018111 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 339 (D339G)
Ref Sequence ENSEMBL: ENSMUSP00000103997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049167] [ENSMUST00000108360]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049167
AA Change: D339G

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044990
Gene: ENSMUSG00000037791
AA Change: D339G

DomainStartEndE-ValueType
low complexity region 37 52 N/A INTRINSIC
PHD 58 103 7.23e-11 SMART
low complexity region 182 200 N/A INTRINSIC
Pfam:PHF12_MRG_bd 202 241 1.3e-21 PFAM
PHD 273 319 1.66e-10 SMART
low complexity region 616 630 N/A INTRINSIC
Blast:FHA 813 868 9e-34 BLAST
low complexity region 905 916 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108360
AA Change: D339G

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103997
Gene: ENSMUSG00000037791
AA Change: D339G

DomainStartEndE-ValueType
low complexity region 37 52 N/A INTRINSIC
PHD 58 103 7.23e-11 SMART
low complexity region 182 200 N/A INTRINSIC
PDB:2L9S|A 201 241 2e-20 PDB
PHD 273 319 1.66e-10 SMART
low complexity region 616 630 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrv1 C A 9: 36,694,281 S41R probably damaging Het
Aqr G A 2: 114,148,970 T328M probably damaging Het
Arhgap26 C A 18: 39,099,618 D99E probably damaging Het
Boc G A 16: 44,492,824 T559I probably damaging Het
Cadps A T 14: 12,473,497 I876N possibly damaging Het
Cep72 T C 13: 74,040,141 Q211R probably benign Het
Clmp T C 9: 40,772,530 probably null Het
Coq6 T A 12: 84,368,639 D145E probably benign Het
Crym T C 7: 120,201,893 E11G probably benign Het
Defb36 T A 2: 152,612,583 V54E probably damaging Het
Dlg5 C A 14: 24,192,913 E55* probably null Het
Dock2 G T 11: 34,727,406 R128S probably damaging Het
E330034G19Rik A G 14: 24,296,824 K60E possibly damaging Het
Eps8l2 G A 7: 141,355,007 R76Q possibly damaging Het
Espn T C 4: 152,123,780 E460G probably damaging Het
Fbxl18 A G 5: 142,895,267 probably benign Het
Fgd5 T C 6: 91,988,687 S476P probably damaging Het
Gsto1 T C 19: 47,857,899 W62R probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gxylt1 A G 15: 93,254,299 probably null Het
Hs6st1 C T 1: 36,103,638 P218L probably benign Het
Kif5c A G 2: 49,730,199 D226G possibly damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Lpxn T A 19: 12,832,659 M265K possibly damaging Het
Map3k9 A G 12: 81,732,024 L505P possibly damaging Het
Mcm3ap C T 10: 76,481,096 R645W possibly damaging Het
Msr1 T C 8: 39,611,719 I305V probably benign Het
Muc4 A G 16: 32,777,692 E3237G possibly damaging Het
Necap1 T C 6: 122,881,512 F105L probably damaging Het
Nploc4 C T 11: 120,384,614 V499M probably benign Het
Nup93 T C 8: 94,314,670 V812A probably damaging Het
Olfr1012 G A 2: 85,759,650 S242F probably damaging Het
Olfr1328 T A 4: 118,934,066 I259F possibly damaging Het
Olfr49 A G 14: 54,282,368 F176L probably damaging Het
Parn G A 16: 13,665,930 P50L probably damaging Het
Pcdhb7 T C 18: 37,344,171 C787R probably benign Het
Pdk2 A T 11: 95,030,000 I175N probably damaging Het
Pelo T C 13: 115,089,616 I102V probably benign Het
Phlpp1 A T 1: 106,173,432 I477F probably benign Het
Pigt T A 2: 164,501,562 Y319* probably null Het
Pmpca A G 2: 26,390,541 E133G probably damaging Het
Ptgs2 A G 1: 150,104,108 I321M probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Qsox2 A G 2: 26,225,218 M1T probably null Het
Rara C G 11: 98,972,652 R382G probably damaging Het
Rbbp6 A G 7: 123,001,834 probably benign Het
Rev3l T C 10: 39,852,075 probably null Het
Robo3 T A 9: 37,425,275 Y399F possibly damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Skint3 A G 4: 112,235,798 M20V probably benign Het
Slc17a6 A G 7: 51,658,756 D276G probably benign Het
Sult3a2 A T 10: 33,778,272 V128D probably damaging Het
Syt3 T A 7: 44,390,619 V92E possibly damaging Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Utp14b G A 1: 78,665,401 D339N probably damaging Het
Vars T C 17: 35,016,238 F1259L probably benign Het
Vmn1r115 A C 7: 20,844,630 V119G possibly damaging Het
Zc3h12a C T 4: 125,120,373 R293H probably damaging Het
Zfp638 A T 6: 83,979,188 E1592D probably damaging Het
Other mutations in Phf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Phf12 APN 11 78015506 missense probably damaging 0.98
IGL00919:Phf12 APN 11 77983340 missense probably damaging 1.00
IGL01434:Phf12 APN 11 78023559 missense probably damaging 1.00
IGL02219:Phf12 APN 11 77984196 missense probably damaging 0.97
IGL02727:Phf12 APN 11 78023667 missense possibly damaging 0.83
IGL03064:Phf12 APN 11 77983360 missense probably damaging 1.00
IGL03117:Phf12 APN 11 78023020 unclassified probably benign
R0457:Phf12 UTSW 11 78018168 missense possibly damaging 0.94
R0477:Phf12 UTSW 11 78023070 missense possibly damaging 0.94
R0656:Phf12 UTSW 11 78029332 missense probably benign 0.44
R0905:Phf12 UTSW 11 78009404 nonsense probably null
R1719:Phf12 UTSW 11 78023601 missense probably damaging 1.00
R1742:Phf12 UTSW 11 78009486 missense probably benign 0.04
R1826:Phf12 UTSW 11 78024954 splice site probably benign
R2270:Phf12 UTSW 11 77984175 missense possibly damaging 0.82
R2875:Phf12 UTSW 11 78009747 missense probably damaging 1.00
R2885:Phf12 UTSW 11 78023769 missense possibly damaging 0.75
R5020:Phf12 UTSW 11 78023796 missense probably damaging 1.00
R5573:Phf12 UTSW 11 78025045 missense probably damaging 1.00
R5689:Phf12 UTSW 11 78023725 missense probably damaging 1.00
R5727:Phf12 UTSW 11 78023544 missense probably damaging 1.00
R5807:Phf12 UTSW 11 78022426 missense probably benign 0.16
R5910:Phf12 UTSW 11 78027398 missense probably damaging 1.00
R6034:Phf12 UTSW 11 78018069 missense probably benign 0.08
R6034:Phf12 UTSW 11 78018069 missense probably benign 0.08
R6049:Phf12 UTSW 11 78028170 unclassified probably null
R6052:Phf12 UTSW 11 78018218 missense probably benign 0.31
R6056:Phf12 UTSW 11 78009515 missense probably benign 0.09
R6208:Phf12 UTSW 11 78023591 missense probably damaging 0.97
R6644:Phf12 UTSW 11 78026092 makesense probably null
R6805:Phf12 UTSW 11 78027373 missense probably damaging 1.00
R6823:Phf12 UTSW 11 78022511 nonsense probably null
R7047:Phf12 UTSW 11 78013273 missense probably damaging 0.99
R7159:Phf12 UTSW 11 78023540 missense possibly damaging 0.76
X0013:Phf12 UTSW 11 78009791 missense probably damaging 1.00
X0027:Phf12 UTSW 11 78028895 unclassified probably null
Predicted Primers PCR Primer
(F):5'- AAGGCATTTCCAGGCTACTTC -3'
(R):5'- TACTTGCCGAGACACCAAAG -3'

Sequencing Primer
(F):5'- CACAAAAGCAGGTGTTTCCTTACTC -3'
(R):5'- GACATATCTTACTGAAAGGGCTGTG -3'
Posted On2016-10-24