Incidental Mutation 'R5570:Rara'
ID435625
Institutional Source Beutler Lab
Gene Symbol Rara
Ensembl Gene ENSMUSG00000037992
Gene Nameretinoic acid receptor, alpha
SynonymsRAR alpha 1, RARalpha1
MMRRC Submission 043127-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5570 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98927818-98974942 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 98972652 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 382 (R382G)
Ref Sequence ENSEMBL: ENSMUSP00000103097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068133] [ENSMUST00000107473] [ENSMUST00000107474] [ENSMUST00000107475] [ENSMUST00000164748]
Predicted Effect probably damaging
Transcript: ENSMUST00000068133
AA Change: R385G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069744
Gene: ENSMUSG00000037992
AA Change: R385G

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107473
AA Change: R382G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103097
Gene: ENSMUSG00000037992
AA Change: R382G

DomainStartEndE-ValueType
low complexity region 54 77 N/A INTRINSIC
ZnF_C4 82 153 7.53e-40 SMART
HOLI 227 385 1.22e-34 SMART
low complexity region 422 433 N/A INTRINSIC
low complexity region 436 459 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107474
AA Change: R385G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103098
Gene: ENSMUSG00000037992
AA Change: R385G

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107475
AA Change: R385G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103099
Gene: ENSMUSG00000037992
AA Change: R385G

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164748
AA Change: R385G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129791
Gene: ENSMUSG00000037992
AA Change: R385G

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a nuclear retinoic acid receptor. The encoded protein, retinoic acid receptor alpha, regulates transcription in a ligand-dependent manner. This gene has been implicated in regulation of development, differentiation, apoptosis, granulopoeisis, and transcription of clock genes. Translocations between this locus and several other loci have been associated with acute promyelocytic leukemia. Alternatively spliced transcript variants have been found for this locus.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for targeted null mutations show high neonatal mortality due to maternal cannibalization, failure to thrive, and excess mortality during the postnatal period. Male survivors exhibit testicular degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrv1 C A 9: 36,694,281 S41R probably damaging Het
Aqr G A 2: 114,148,970 T328M probably damaging Het
Arhgap26 C A 18: 39,099,618 D99E probably damaging Het
Boc G A 16: 44,492,824 T559I probably damaging Het
Cadps A T 14: 12,473,497 I876N possibly damaging Het
Cep72 T C 13: 74,040,141 Q211R probably benign Het
Clmp T C 9: 40,772,530 probably null Het
Coq6 T A 12: 84,368,639 D145E probably benign Het
Crym T C 7: 120,201,893 E11G probably benign Het
Defb36 T A 2: 152,612,583 V54E probably damaging Het
Dlg5 C A 14: 24,192,913 E55* probably null Het
Dock2 G T 11: 34,727,406 R128S probably damaging Het
E330034G19Rik A G 14: 24,296,824 K60E possibly damaging Het
Eps8l2 G A 7: 141,355,007 R76Q possibly damaging Het
Espn T C 4: 152,123,780 E460G probably damaging Het
Fbxl18 A G 5: 142,895,267 probably benign Het
Fgd5 T C 6: 91,988,687 S476P probably damaging Het
Gsto1 T C 19: 47,857,899 W62R probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gxylt1 A G 15: 93,254,299 probably null Het
Hs6st1 C T 1: 36,103,638 P218L probably benign Het
Kif5c A G 2: 49,730,199 D226G possibly damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Lpxn T A 19: 12,832,659 M265K possibly damaging Het
Map3k9 A G 12: 81,732,024 L505P possibly damaging Het
Mcm3ap C T 10: 76,481,096 R645W possibly damaging Het
Msr1 T C 8: 39,611,719 I305V probably benign Het
Muc4 A G 16: 32,777,692 E3237G possibly damaging Het
Necap1 T C 6: 122,881,512 F105L probably damaging Het
Nploc4 C T 11: 120,384,614 V499M probably benign Het
Nup93 T C 8: 94,314,670 V812A probably damaging Het
Olfr1012 G A 2: 85,759,650 S242F probably damaging Het
Olfr1328 T A 4: 118,934,066 I259F possibly damaging Het
Olfr49 A G 14: 54,282,368 F176L probably damaging Het
Parn G A 16: 13,665,930 P50L probably damaging Het
Pcdhb7 T C 18: 37,344,171 C787R probably benign Het
Pdk2 A T 11: 95,030,000 I175N probably damaging Het
Pelo T C 13: 115,089,616 I102V probably benign Het
Phf12 A G 11: 78,018,111 D339G possibly damaging Het
Phlpp1 A T 1: 106,173,432 I477F probably benign Het
Pigt T A 2: 164,501,562 Y319* probably null Het
Pmpca A G 2: 26,390,541 E133G probably damaging Het
Ptgs2 A G 1: 150,104,108 I321M probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Qsox2 A G 2: 26,225,218 M1T probably null Het
Rbbp6 A G 7: 123,001,834 probably benign Het
Rev3l T C 10: 39,852,075 probably null Het
Robo3 T A 9: 37,425,275 Y399F possibly damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Skint3 A G 4: 112,235,798 M20V probably benign Het
Slc17a6 A G 7: 51,658,756 D276G probably benign Het
Sult3a2 A T 10: 33,778,272 V128D probably damaging Het
Syt3 T A 7: 44,390,619 V92E possibly damaging Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Utp14b G A 1: 78,665,401 D339N probably damaging Het
Vars T C 17: 35,016,238 F1259L probably benign Het
Vmn1r115 A C 7: 20,844,630 V119G possibly damaging Het
Zc3h12a C T 4: 125,120,373 R293H probably damaging Het
Zfp638 A T 6: 83,979,188 E1592D probably damaging Het
Other mutations in Rara
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Rara APN 11 98968166 missense probably benign 0.00
IGL01155:Rara APN 11 98968184 missense possibly damaging 0.92
IGL02141:Rara APN 11 98968081 missense probably damaging 1.00
IGL03194:Rara APN 11 98971664 missense possibly damaging 0.96
PIT4486001:Rara UTSW 11 98973495 missense possibly damaging 0.88
R0626:Rara UTSW 11 98971580 critical splice acceptor site probably null
R1973:Rara UTSW 11 98971670 missense possibly damaging 0.91
R3975:Rara UTSW 11 98970569 missense probably damaging 1.00
R4357:Rara UTSW 11 98968111 missense probably damaging 0.98
R5102:Rara UTSW 11 98966359 missense possibly damaging 0.80
R5147:Rara UTSW 11 98950724 missense probably benign 0.35
R5381:Rara UTSW 11 98971584 missense possibly damaging 0.93
R5861:Rara UTSW 11 98968161 nonsense probably null
R6273:Rara UTSW 11 98970222 missense probably benign 0.00
R6404:Rara UTSW 11 98961013 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CCTGCTCAGGGACAGTTTTG -3'
(R):5'- AAGACACCATGTAGATGCCAAG -3'

Sequencing Primer
(F):5'- GACAGTTTTGTGCTCAGACCGAC -3'
(R):5'- ATGGCGCAACCCTTTAATACAGTTC -3'
Posted On2016-10-24