Incidental Mutation 'R5570:Coq6'
ID435629
Institutional Source Beutler Lab
Gene Symbol Coq6
Ensembl Gene ENSMUSG00000021235
Gene Namecoenzyme Q6 monooxygenase
Synonyms5930427M12Rik
MMRRC Submission 043127-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5570 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location84361657-84373796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84368639 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 145 (D145E)
Ref Sequence ENSEMBL: ENSMUSP00000115676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021661] [ENSMUST00000110276] [ENSMUST00000110278] [ENSMUST00000152913]
Predicted Effect probably benign
Transcript: ENSMUST00000021661
AA Change: D145E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021661
Gene: ENSMUSG00000021235
AA Change: D145E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 3.9e-8 PFAM
Pfam:FAD_binding_3 334 435 1.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110276
AA Change: D145E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105905
Gene: ENSMUSG00000021235
AA Change: D145E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 5.1e-8 PFAM
Pfam:FAD_binding_3 334 435 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110278
AA Change: D145E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105907
Gene: ENSMUSG00000021235
AA Change: D145E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 6.8e-8 PFAM
Pfam:FAD_binding_3 334 410 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140961
Predicted Effect unknown
Transcript: ENSMUST00000145522
AA Change: D140E
SMART Domains Protein: ENSMUSP00000117609
Gene: ENSMUSG00000021235
AA Change: D140E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SCOP:d1foha5 35 167 2e-6 SMART
PDB:4K22|B 90 156 3e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150391
Predicted Effect probably benign
Transcript: ENSMUST00000152913
AA Change: D145E

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000115676
Gene: ENSMUSG00000021235
AA Change: D145E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1foha5 39 269 1e-10 SMART
PDB:4K22|B 94 274 1e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156592
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ubiH/COQ6 family. It is an evolutionarily conserved monooxygenase required for the biosynthesis of coenzyme Q10 (or ubiquinone), which is an essential component of the mitochondrial electron transport chain, and one of the most potent lipophilic antioxidants implicated in the protection of cell damage by reactive oxygen species. Knockdown of this gene in mouse and zebrafish results in decreased growth due to increased apoptosis. Mutations in this gene are associated with autosomal recessive coenzyme Q10 deficiency-6 (COQ10D6), which manifests as nephrotic syndrome with sensorineural deafness. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrv1 C A 9: 36,694,281 S41R probably damaging Het
Aqr G A 2: 114,148,970 T328M probably damaging Het
Arhgap26 C A 18: 39,099,618 D99E probably damaging Het
Boc G A 16: 44,492,824 T559I probably damaging Het
Cadps A T 14: 12,473,497 I876N possibly damaging Het
Cep72 T C 13: 74,040,141 Q211R probably benign Het
Clmp T C 9: 40,772,530 probably null Het
Crym T C 7: 120,201,893 E11G probably benign Het
Defb36 T A 2: 152,612,583 V54E probably damaging Het
Dlg5 C A 14: 24,192,913 E55* probably null Het
Dock2 G T 11: 34,727,406 R128S probably damaging Het
E330034G19Rik A G 14: 24,296,824 K60E possibly damaging Het
Eps8l2 G A 7: 141,355,007 R76Q possibly damaging Het
Espn T C 4: 152,123,780 E460G probably damaging Het
Fbxl18 A G 5: 142,895,267 probably benign Het
Fgd5 T C 6: 91,988,687 S476P probably damaging Het
Gsto1 T C 19: 47,857,899 W62R probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gxylt1 A G 15: 93,254,299 probably null Het
Hs6st1 C T 1: 36,103,638 P218L probably benign Het
Kif5c A G 2: 49,730,199 D226G possibly damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Lpxn T A 19: 12,832,659 M265K possibly damaging Het
Map3k9 A G 12: 81,732,024 L505P possibly damaging Het
Mcm3ap C T 10: 76,481,096 R645W possibly damaging Het
Msr1 T C 8: 39,611,719 I305V probably benign Het
Muc4 A G 16: 32,777,692 E3237G possibly damaging Het
Necap1 T C 6: 122,881,512 F105L probably damaging Het
Nploc4 C T 11: 120,384,614 V499M probably benign Het
Nup93 T C 8: 94,314,670 V812A probably damaging Het
Olfr1012 G A 2: 85,759,650 S242F probably damaging Het
Olfr1328 T A 4: 118,934,066 I259F possibly damaging Het
Olfr49 A G 14: 54,282,368 F176L probably damaging Het
Parn G A 16: 13,665,930 P50L probably damaging Het
Pcdhb7 T C 18: 37,344,171 C787R probably benign Het
Pdk2 A T 11: 95,030,000 I175N probably damaging Het
Pelo T C 13: 115,089,616 I102V probably benign Het
Phf12 A G 11: 78,018,111 D339G possibly damaging Het
Phlpp1 A T 1: 106,173,432 I477F probably benign Het
Pigt T A 2: 164,501,562 Y319* probably null Het
Pmpca A G 2: 26,390,541 E133G probably damaging Het
Ptgs2 A G 1: 150,104,108 I321M probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Qsox2 A G 2: 26,225,218 M1T probably null Het
Rara C G 11: 98,972,652 R382G probably damaging Het
Rbbp6 A G 7: 123,001,834 probably benign Het
Rev3l T C 10: 39,852,075 probably null Het
Robo3 T A 9: 37,425,275 Y399F possibly damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Skint3 A G 4: 112,235,798 M20V probably benign Het
Slc17a6 A G 7: 51,658,756 D276G probably benign Het
Sult3a2 A T 10: 33,778,272 V128D probably damaging Het
Syt3 T A 7: 44,390,619 V92E possibly damaging Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Utp14b G A 1: 78,665,401 D339N probably damaging Het
Vars T C 17: 35,016,238 F1259L probably benign Het
Vmn1r115 A C 7: 20,844,630 V119G possibly damaging Het
Zc3h12a C T 4: 125,120,373 R293H probably damaging Het
Zfp638 A T 6: 83,979,188 E1592D probably damaging Het
Other mutations in Coq6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0508:Coq6 UTSW 12 84368139 splice site probably benign
R0607:Coq6 UTSW 12 84368638 missense possibly damaging 0.95
R1221:Coq6 UTSW 12 84371527 missense possibly damaging 0.96
R1885:Coq6 UTSW 12 84372464 missense probably damaging 1.00
R1898:Coq6 UTSW 12 84366963 missense probably benign 0.38
R3153:Coq6 UTSW 12 84371535 missense probably damaging 1.00
R3824:Coq6 UTSW 12 84372415 splice site probably benign
R4015:Coq6 UTSW 12 84366897 missense probably benign 0.00
R4241:Coq6 UTSW 12 84373789 utr 3 prime probably benign
R4285:Coq6 UTSW 12 84370404 intron probably benign
R4353:Coq6 UTSW 12 84368149 missense probably damaging 0.99
R4598:Coq6 UTSW 12 84362139 missense probably benign 0.00
R4599:Coq6 UTSW 12 84362139 missense probably benign 0.00
R4868:Coq6 UTSW 12 84370952 missense probably damaging 0.99
R4887:Coq6 UTSW 12 84372296 missense probably damaging 1.00
R5567:Coq6 UTSW 12 84368639 missense probably benign 0.10
R5715:Coq6 UTSW 12 84366907 missense probably benign 0.10
R6608:Coq6 UTSW 12 84372148 missense probably benign 0.00
R7035:Coq6 UTSW 12 84368641 missense probably damaging 0.99
R7096:Coq6 UTSW 12 84361821 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGACCACGAGTCTCGCTTTATG -3'
(R):5'- AGCTCTTATTTGCCAGCCTCAG -3'

Sequencing Primer
(F):5'- CGCTTTATGTCCTGCCAAAGAGG -3'
(R):5'- CTCCCTCAGGCTGGCATTAAAG -3'
Posted On2016-10-24