Incidental Mutation 'R5570:Vars'
ID435643
Institutional Source Beutler Lab
Gene Symbol Vars
Ensembl Gene ENSMUSG00000007029
Gene Namevalyl-tRNA synthetase
SynonymsBat-6, Bat6, G7a, D17H6S56E, Vars2
MMRRC Submission 043127-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R5570 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35000987-35016322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35016238 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1259 (F1259L)
Ref Sequence ENSEMBL: ENSMUSP00000084572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007245] [ENSMUST00000087315] [ENSMUST00000172499] [ENSMUST00000173584]
Predicted Effect probably benign
Transcript: ENSMUST00000007245
SMART Domains Protein: ENSMUSP00000007245
Gene: ENSMUSG00000007030

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VWA 314 499 2.59e0 SMART
low complexity region 683 701 N/A INTRINSIC
low complexity region 840 861 N/A INTRINSIC
low complexity region 864 877 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087315
AA Change: F1259L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000084572
Gene: ENSMUSG00000007029
AA Change: F1259L

DomainStartEndE-ValueType
Pfam:GST_N 2 81 5.7e-16 PFAM
Pfam:GST_C 107 198 7.3e-13 PFAM
low complexity region 234 256 N/A INTRINSIC
low complexity region 261 271 N/A INTRINSIC
Pfam:tRNA-synt_1 307 938 2e-197 PFAM
Pfam:tRNA-synt_1g 336 496 6e-6 PFAM
Pfam:tRNA-synt_1_2 555 623 1.9e-11 PFAM
Pfam:Anticodon_1 983 1138 2.6e-34 PFAM
low complexity region 1153 1174 N/A INTRINSIC
low complexity region 1207 1225 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172499
SMART Domains Protein: ENSMUSP00000133418
Gene: ENSMUSG00000007030

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VWA 314 478 7.28e0 SMART
low complexity region 662 680 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
low complexity region 843 856 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172999
Predicted Effect probably benign
Transcript: ENSMUST00000173142
SMART Domains Protein: ENSMUSP00000134669
Gene: ENSMUSG00000007029

DomainStartEndE-ValueType
SCOP:d1gaxa3 32 67 3e-7 SMART
PDB:1IYW|B 36 122 4e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173336
Predicted Effect probably benign
Transcript: ENSMUST00000173584
SMART Domains Protein: ENSMUSP00000133994
Gene: ENSMUSG00000007029

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
Pfam:GST_C 96 198 7.8e-14 PFAM
low complexity region 234 256 N/A INTRINSIC
low complexity region 261 271 N/A INTRINSIC
Pfam:tRNA-synt_1 307 938 1.9e-200 PFAM
Pfam:tRNA-synt_1g 336 493 2.1e-7 PFAM
Pfam:tRNA-synt_1_2 555 623 1.1e-12 PFAM
Pfam:Anticodon_1 983 1138 7.2e-36 PFAM
low complexity region 1153 1174 N/A INTRINSIC
coiled coil region 1197 1225 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174084
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. The protein encoded by this gene belongs to class-I aminoacyl-tRNA synthetase family and is located in the class III region of the major histocompatibility complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrv1 C A 9: 36,694,281 S41R probably damaging Het
Aqr G A 2: 114,148,970 T328M probably damaging Het
Arhgap26 C A 18: 39,099,618 D99E probably damaging Het
Boc G A 16: 44,492,824 T559I probably damaging Het
Cadps A T 14: 12,473,497 I876N possibly damaging Het
Cep72 T C 13: 74,040,141 Q211R probably benign Het
Clmp T C 9: 40,772,530 probably null Het
Coq6 T A 12: 84,368,639 D145E probably benign Het
Crym T C 7: 120,201,893 E11G probably benign Het
Defb36 T A 2: 152,612,583 V54E probably damaging Het
Dlg5 C A 14: 24,192,913 E55* probably null Het
Dock2 G T 11: 34,727,406 R128S probably damaging Het
E330034G19Rik A G 14: 24,296,824 K60E possibly damaging Het
Eps8l2 G A 7: 141,355,007 R76Q possibly damaging Het
Espn T C 4: 152,123,780 E460G probably damaging Het
Fbxl18 A G 5: 142,895,267 probably benign Het
Fgd5 T C 6: 91,988,687 S476P probably damaging Het
Gsto1 T C 19: 47,857,899 W62R probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gxylt1 A G 15: 93,254,299 probably null Het
Hs6st1 C T 1: 36,103,638 P218L probably benign Het
Kif5c A G 2: 49,730,199 D226G possibly damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Lpxn T A 19: 12,832,659 M265K possibly damaging Het
Map3k9 A G 12: 81,732,024 L505P possibly damaging Het
Mcm3ap C T 10: 76,481,096 R645W possibly damaging Het
Msr1 T C 8: 39,611,719 I305V probably benign Het
Muc4 A G 16: 32,777,692 E3237G possibly damaging Het
Necap1 T C 6: 122,881,512 F105L probably damaging Het
Nploc4 C T 11: 120,384,614 V499M probably benign Het
Nup93 T C 8: 94,314,670 V812A probably damaging Het
Olfr1012 G A 2: 85,759,650 S242F probably damaging Het
Olfr1328 T A 4: 118,934,066 I259F possibly damaging Het
Olfr49 A G 14: 54,282,368 F176L probably damaging Het
Parn G A 16: 13,665,930 P50L probably damaging Het
Pcdhb7 T C 18: 37,344,171 C787R probably benign Het
Pdk2 A T 11: 95,030,000 I175N probably damaging Het
Pelo T C 13: 115,089,616 I102V probably benign Het
Phf12 A G 11: 78,018,111 D339G possibly damaging Het
Phlpp1 A T 1: 106,173,432 I477F probably benign Het
Pigt T A 2: 164,501,562 Y319* probably null Het
Pmpca A G 2: 26,390,541 E133G probably damaging Het
Ptgs2 A G 1: 150,104,108 I321M probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Qsox2 A G 2: 26,225,218 M1T probably null Het
Rara C G 11: 98,972,652 R382G probably damaging Het
Rbbp6 A G 7: 123,001,834 probably benign Het
Rev3l T C 10: 39,852,075 probably null Het
Robo3 T A 9: 37,425,275 Y399F possibly damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Skint3 A G 4: 112,235,798 M20V probably benign Het
Slc17a6 A G 7: 51,658,756 D276G probably benign Het
Sult3a2 A T 10: 33,778,272 V128D probably damaging Het
Syt3 T A 7: 44,390,619 V92E possibly damaging Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Utp14b G A 1: 78,665,401 D339N probably damaging Het
Vmn1r115 A C 7: 20,844,630 V119G possibly damaging Het
Zc3h12a C T 4: 125,120,373 R293H probably damaging Het
Zfp638 A T 6: 83,979,188 E1592D probably damaging Het
Other mutations in Vars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Vars APN 17 35013873 missense probably benign 0.00
IGL02160:Vars APN 17 35001502 missense probably damaging 1.00
IGL02303:Vars APN 17 35015484 splice site probably benign
IGL03027:Vars APN 17 35013687 missense probably damaging 1.00
maladroit UTSW 17 35005475 missense probably benign 0.30
whoops UTSW 17 35013644 missense probably damaging 1.00
FR4304:Vars UTSW 17 35015989 small insertion probably benign
FR4548:Vars UTSW 17 35015989 small insertion probably benign
FR4548:Vars UTSW 17 35015991 small insertion probably benign
FR4589:Vars UTSW 17 35015988 small insertion probably benign
R0045:Vars UTSW 17 35010619 missense probably damaging 1.00
R0045:Vars UTSW 17 34998066 missense probably benign 0.13
R0045:Vars UTSW 17 35010619 missense probably damaging 1.00
R0266:Vars UTSW 17 35013869 missense probably benign 0.00
R0267:Vars UTSW 17 35011596 splice site probably benign
R0391:Vars UTSW 17 35011486 missense possibly damaging 0.79
R0445:Vars UTSW 17 35011809 missense probably benign 0.31
R0449:Vars UTSW 17 35012727 splice site probably null
R0557:Vars UTSW 17 35004984 missense possibly damaging 0.90
R0559:Vars UTSW 17 35014058 nonsense probably null
R0730:Vars UTSW 17 35014300 missense probably damaging 1.00
R0748:Vars UTSW 17 34998012 missense probably damaging 1.00
R1692:Vars UTSW 17 35013725 missense probably damaging 1.00
R1693:Vars UTSW 17 34998196 missense probably benign 0.31
R1697:Vars UTSW 17 34998222 missense probably benign 0.43
R1699:Vars UTSW 17 35014758 missense possibly damaging 0.93
R1712:Vars UTSW 17 35014752 missense probably damaging 1.00
R1989:Vars UTSW 17 35011838 missense possibly damaging 0.94
R2349:Vars UTSW 17 35015752 missense probably benign
R2365:Vars UTSW 17 35015452 missense probably benign 0.01
R3790:Vars UTSW 17 34999334 missense probably benign 0.34
R4615:Vars UTSW 17 35013881 missense probably damaging 0.97
R4844:Vars UTSW 17 35011612 missense probably damaging 1.00
R4856:Vars UTSW 17 35015726 missense probably benign 0.37
R4886:Vars UTSW 17 35015726 missense probably benign 0.37
R5706:Vars UTSW 17 35005481 unclassified probably null
R5858:Vars UTSW 17 35005475 missense probably benign 0.30
R5907:Vars UTSW 17 35012376 missense probably damaging 1.00
R5917:Vars UTSW 17 35012515 missense probably damaging 0.99
R5944:Vars UTSW 17 35013644 missense probably damaging 1.00
R6023:Vars UTSW 17 35001609 missense probably damaging 1.00
R6073:Vars UTSW 17 35001529 missense probably benign
R6273:Vars UTSW 17 35013743 missense probably damaging 1.00
R6390:Vars UTSW 17 35015639 missense probably benign 0.00
R6658:Vars UTSW 17 35015741 missense probably benign 0.03
R7067:Vars UTSW 17 35011479 missense probably damaging 0.98
R7387:Vars UTSW 17 35004792 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCAAGAAAAGAAGCGCTCTAGAG -3'
(R):5'- TGCAGTGCAGTGAGGTGAAC -3'

Sequencing Primer
(F):5'- AGGGACTTGGAAGCCTGCTG -3'
(R):5'- GCACTGTGCCAGAGACAGAC -3'
Posted On2016-10-24