Incidental Mutation 'R5570:Lpxn'
ID435646
Institutional Source Beutler Lab
Gene Symbol Lpxn
Ensembl Gene ENSMUSG00000024696
Gene Nameleupaxin
Synonyms4933402K05Rik, A530083L21Rik
MMRRC Submission 043127-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5570 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12798606-12833807 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12832659 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 265 (M265K)
Ref Sequence ENSEMBL: ENSMUSP00000025601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025601]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025601
AA Change: M265K

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025601
Gene: ENSMUSG00000024696
AA Change: M265K

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
LIM 151 202 3.17e-17 SMART
LIM 210 261 1.98e-18 SMART
LIM 269 320 3.26e-19 SMART
LIM 328 379 3.34e-16 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product encoded by this gene is preferentially expressed in hematopoietic cells and belongs to the paxillin protein family. Similar to other members of this focal-adhesion-associated adaptor-protein family, it has four leucine-rich LD-motifs in the N-terminus and four LIM domains in the C-terminus. It may function in cell type-specific signaling by associating with PYK2, a member of focal adhesion kinase family. As a substrate for a tyrosine kinase in lymphoid cells, this protein may also function in, and be regulated by, tyrosine kinase activity. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrv1 C A 9: 36,694,281 S41R probably damaging Het
Aqr G A 2: 114,148,970 T328M probably damaging Het
Arhgap26 C A 18: 39,099,618 D99E probably damaging Het
Boc G A 16: 44,492,824 T559I probably damaging Het
Cadps A T 14: 12,473,497 I876N possibly damaging Het
Cep72 T C 13: 74,040,141 Q211R probably benign Het
Clmp T C 9: 40,772,530 probably null Het
Coq6 T A 12: 84,368,639 D145E probably benign Het
Crym T C 7: 120,201,893 E11G probably benign Het
Defb36 T A 2: 152,612,583 V54E probably damaging Het
Dlg5 C A 14: 24,192,913 E55* probably null Het
Dock2 G T 11: 34,727,406 R128S probably damaging Het
E330034G19Rik A G 14: 24,296,824 K60E possibly damaging Het
Eps8l2 G A 7: 141,355,007 R76Q possibly damaging Het
Espn T C 4: 152,123,780 E460G probably damaging Het
Fbxl18 A G 5: 142,895,267 probably benign Het
Fgd5 T C 6: 91,988,687 S476P probably damaging Het
Gsto1 T C 19: 47,857,899 W62R probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gxylt1 A G 15: 93,254,299 probably null Het
Hs6st1 C T 1: 36,103,638 P218L probably benign Het
Kif5c A G 2: 49,730,199 D226G possibly damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Map3k9 A G 12: 81,732,024 L505P possibly damaging Het
Mcm3ap C T 10: 76,481,096 R645W possibly damaging Het
Msr1 T C 8: 39,611,719 I305V probably benign Het
Muc4 A G 16: 32,777,692 E3237G possibly damaging Het
Necap1 T C 6: 122,881,512 F105L probably damaging Het
Nploc4 C T 11: 120,384,614 V499M probably benign Het
Nup93 T C 8: 94,314,670 V812A probably damaging Het
Olfr1012 G A 2: 85,759,650 S242F probably damaging Het
Olfr1328 T A 4: 118,934,066 I259F possibly damaging Het
Olfr49 A G 14: 54,282,368 F176L probably damaging Het
Parn G A 16: 13,665,930 P50L probably damaging Het
Pcdhb7 T C 18: 37,344,171 C787R probably benign Het
Pdk2 A T 11: 95,030,000 I175N probably damaging Het
Pelo T C 13: 115,089,616 I102V probably benign Het
Phf12 A G 11: 78,018,111 D339G possibly damaging Het
Phlpp1 A T 1: 106,173,432 I477F probably benign Het
Pigt T A 2: 164,501,562 Y319* probably null Het
Pmpca A G 2: 26,390,541 E133G probably damaging Het
Ptgs2 A G 1: 150,104,108 I321M probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Qsox2 A G 2: 26,225,218 M1T probably null Het
Rara C G 11: 98,972,652 R382G probably damaging Het
Rbbp6 A G 7: 123,001,834 probably benign Het
Rev3l T C 10: 39,852,075 probably null Het
Robo3 T A 9: 37,425,275 Y399F possibly damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Skint3 A G 4: 112,235,798 M20V probably benign Het
Slc17a6 A G 7: 51,658,756 D276G probably benign Het
Sult3a2 A T 10: 33,778,272 V128D probably damaging Het
Syt3 T A 7: 44,390,619 V92E possibly damaging Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Utp14b G A 1: 78,665,401 D339N probably damaging Het
Vars T C 17: 35,016,238 F1259L probably benign Het
Vmn1r115 A C 7: 20,844,630 V119G possibly damaging Het
Zc3h12a C T 4: 125,120,373 R293H probably damaging Het
Zfp638 A T 6: 83,979,188 E1592D probably damaging Het
Other mutations in Lpxn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01895:Lpxn APN 19 12833086 missense probably damaging 0.99
IGL03088:Lpxn APN 19 12833211 missense probably damaging 1.00
IGL03203:Lpxn APN 19 12819406 missense probably benign 0.01
mascherano UTSW 19 12833172 missense probably damaging 0.99
R0848:Lpxn UTSW 19 12804037 missense probably benign
R1514:Lpxn UTSW 19 12824050 missense probably damaging 1.00
R1532:Lpxn UTSW 19 12804092 critical splice donor site probably null
R1880:Lpxn UTSW 19 12804088 missense probably benign 0.17
R1937:Lpxn UTSW 19 12824910 missense probably benign 0.00
R2182:Lpxn UTSW 19 12832758 critical splice donor site probably null
R2897:Lpxn UTSW 19 12819358 missense probably benign 0.01
R4194:Lpxn UTSW 19 12833235 missense probably damaging 1.00
R4576:Lpxn UTSW 19 12833290 missense probably benign 0.17
R4844:Lpxn UTSW 19 12833172 missense probably damaging 0.99
R5567:Lpxn UTSW 19 12832659 missense possibly damaging 0.90
R6060:Lpxn UTSW 19 12833125 missense probably damaging 1.00
R6366:Lpxn UTSW 19 12824799 missense probably benign 0.12
R6615:Lpxn UTSW 19 12824799 missense probably benign 0.12
R7116:Lpxn UTSW 19 12811258 missense probably benign 0.28
R7135:Lpxn UTSW 19 12833319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCGTTTTGAACATGGGC -3'
(R):5'- CACAATTGGTTCTGTGTGCTAC -3'

Sequencing Primer
(F):5'- CGTTTTGAACATGGGCACACTG -3'
(R):5'- GGAAACACAGATTCCTCTCCTTAG -3'
Posted On2016-10-24