Incidental Mutation 'R5571:9530053A07Rik'
ID435666
Institutional Source Beutler Lab
Gene Symbol 9530053A07Rik
Ensembl Gene ENSMUSG00000078776
Gene NameRIKEN cDNA 9530053A07 gene
Synonyms
MMRRC Submission 044395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R5571 (G1)
Quality Score87
Status Validated
Chromosome7
Chromosomal Location28129466-28164811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28156569 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1927 (D1927G)
Ref Sequence ENSEMBL: ENSMUSP00000114986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]
Predicted Effect probably damaging
Transcript: ENSMUST00000059886
AA Change: D1927G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: D1927G

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150948
AA Change: D1927G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: D1927G

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.9%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T A 7: 140,249,123 C232S probably damaging Het
Atad5 T C 11: 80,111,556 V1058A probably benign Het
Baiap2l2 T C 15: 79,271,583 H97R probably damaging Het
Bax A G 7: 45,461,891 S184P probably damaging Het
Bsph1 T G 7: 13,450,915 M1R probably null Het
Cbln2 A G 18: 86,713,148 D27G probably benign Het
Cntnap3 G A 13: 64,903,758 A28V probably damaging Het
Col6a3 C A 1: 90,788,216 R1641L unknown Het
Dhrs3 T G 4: 144,893,564 I17S probably benign Het
Ep300 T C 15: 81,643,217 probably benign Het
Epb41 T C 4: 131,937,406 probably benign Het
Fat4 A T 3: 39,010,274 E4793V probably damaging Het
Fbxw22 T G 9: 109,403,088 K80N probably damaging Het
Fbxw24 T C 9: 109,606,998 E322G probably benign Het
Fndc7 T C 3: 108,856,408 I639V possibly damaging Het
Folh1 T C 7: 86,734,120 Y473C probably damaging Het
Foxb2 T A 19: 16,872,767 M292L probably benign Het
Gapvd1 A G 2: 34,715,253 S41P probably damaging Het
Gm8298 A T 3: 59,877,219 H371L probably damaging Het
Gmds A T 13: 31,917,721 probably null Het
Gp6 G T 7: 4,368,900 A302D probably damaging Het
Hmgcr A T 13: 96,666,663 M8K probably benign Het
Itpripl2 C T 7: 118,489,869 R489Q probably damaging Het
Kmo T C 1: 175,647,194 V175A possibly damaging Het
Lce1i C T 3: 92,777,681 G63S unknown Het
Lrp1b T C 2: 41,408,342 Q155R probably damaging Het
Mdm1 T C 10: 118,159,683 S541P possibly damaging Het
Mgea5 T C 19: 45,777,006 T121A probably benign Het
Neto2 C T 8: 85,640,544 D524N probably damaging Het
Olfr1350 T C 7: 6,570,825 I278T possibly damaging Het
Olfr183 A T 16: 59,000,206 I174L probably benign Het
Olfr319 T A 11: 58,702,051 F117I probably damaging Het
Olfr338 A G 2: 36,377,117 T114A probably benign Het
Ppp4r1 C T 17: 65,803,861 Q21* probably null Het
Ryr2 T A 13: 11,555,448 T4930S possibly damaging Het
Siae G A 9: 37,616,923 G64D probably benign Het
Slc14a2 T C 18: 78,209,067 M10V possibly damaging Het
Ssrp1 C G 2: 85,044,325 D496E probably damaging Het
Steap2 A G 5: 5,675,912 S371P probably damaging Het
Taf6l G A 19: 8,783,930 R24W probably damaging Het
Tbkbp1 T C 11: 97,148,729 Q118R probably damaging Het
Tln2 C T 9: 67,334,320 G1001E possibly damaging Het
Tm2d3 A G 7: 65,699,124 N184D probably damaging Het
Tmprss2 A T 16: 97,590,871 W131R probably null Het
Ube2d2a A G 18: 35,770,478 probably benign Het
Unc13d A G 11: 116,063,654 Y1043H probably benign Het
Usp34 T A 11: 23,457,975 I2600K probably damaging Het
Vmn1r198 A G 13: 22,354,998 Y218C probably damaging Het
Vmn2r8 T C 5: 108,802,240 Y247C probably damaging Het
Wdr59 A T 8: 111,465,831 N699K probably damaging Het
Zcchc2 T C 1: 106,023,672 V579A probably benign Het
Zfhx3 A T 8: 108,955,991 Q3354L unknown Het
Other mutations in 9530053A07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:9530053A07Rik APN 7 28164528 missense probably damaging 1.00
IGL00757:9530053A07Rik APN 7 28154445 missense probably damaging 1.00
IGL01015:9530053A07Rik APN 7 28155318 missense probably damaging 1.00
IGL01079:9530053A07Rik APN 7 28139778 missense probably damaging 0.99
IGL01343:9530053A07Rik APN 7 28150702 missense probably benign 0.19
IGL01420:9530053A07Rik APN 7 28140133 missense probably benign 0.28
IGL01604:9530053A07Rik APN 7 28155324 missense probably benign 0.11
IGL01666:9530053A07Rik APN 7 28153292 missense probably damaging 1.00
IGL02002:9530053A07Rik APN 7 28152796 missense probably damaging 1.00
IGL02036:9530053A07Rik APN 7 28137525 missense possibly damaging 0.82
IGL02126:9530053A07Rik APN 7 28139856 missense probably damaging 1.00
IGL02150:9530053A07Rik APN 7 28146779 nonsense probably null
IGL02219:9530053A07Rik APN 7 28154635 missense probably damaging 1.00
IGL02563:9530053A07Rik APN 7 28157892 missense probably benign
IGL02804:9530053A07Rik APN 7 28153370 missense probably benign 0.00
IGL02830:9530053A07Rik APN 7 28162923 missense probably damaging 1.00
IGL02943:9530053A07Rik APN 7 28147188 missense probably damaging 1.00
IGL02977:9530053A07Rik APN 7 28164372 missense possibly damaging 0.83
IGL03231:9530053A07Rik APN 7 28153722 missense possibly damaging 0.95
IGL03304:9530053A07Rik APN 7 28142242 missense probably damaging 0.99
PIT4378001:9530053A07Rik UTSW 7 28154464 missense possibly damaging 0.61
R0023:9530053A07Rik UTSW 7 28153412 missense probably benign 0.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0132:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0158:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R0230:9530053A07Rik UTSW 7 28156825 missense probably damaging 1.00
R0310:9530053A07Rik UTSW 7 28142274 missense probably benign 0.04
R0448:9530053A07Rik UTSW 7 28140235 missense probably benign 0.03
R0462:9530053A07Rik UTSW 7 28137340 missense probably damaging 1.00
R0481:9530053A07Rik UTSW 7 28153749 missense probably damaging 1.00
R0497:9530053A07Rik UTSW 7 28147465 missense probably damaging 1.00
R0556:9530053A07Rik UTSW 7 28159378 missense probably benign
R0562:9530053A07Rik UTSW 7 28162690 missense probably benign 0.30
R0586:9530053A07Rik UTSW 7 28137091 missense probably damaging 0.99
R0924:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R0930:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R1103:9530053A07Rik UTSW 7 28154520 missense probably damaging 1.00
R1213:9530053A07Rik UTSW 7 28157673 missense probably damaging 1.00
R1292:9530053A07Rik UTSW 7 28142794 splice site probably benign
R1368:9530053A07Rik UTSW 7 28159478 missense possibly damaging 0.89
R1451:9530053A07Rik UTSW 7 28137157 missense probably damaging 1.00
R1477:9530053A07Rik UTSW 7 28157093 missense probably benign 0.01
R1538:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R1655:9530053A07Rik UTSW 7 28147110 missense probably damaging 0.98
R1697:9530053A07Rik UTSW 7 28154347 missense probably damaging 1.00
R1741:9530053A07Rik UTSW 7 28157854 missense probably damaging 0.98
R1796:9530053A07Rik UTSW 7 28155372 missense probably damaging 1.00
R1853:9530053A07Rik UTSW 7 28155546 nonsense probably null
R1861:9530053A07Rik UTSW 7 28154732 missense probably damaging 1.00
R1909:9530053A07Rik UTSW 7 28144348 missense possibly damaging 0.52
R1971:9530053A07Rik UTSW 7 28131512 missense possibly damaging 0.90
R1990:9530053A07Rik UTSW 7 28154360 missense probably damaging 0.98
R2020:9530053A07Rik UTSW 7 28155594 missense probably benign
R2084:9530053A07Rik UTSW 7 28157535 missense probably damaging 1.00
R2125:9530053A07Rik UTSW 7 28158022 missense probably benign 0.00
R2132:9530053A07Rik UTSW 7 28155474 missense probably damaging 1.00
R2513:9530053A07Rik UTSW 7 28131635 missense probably damaging 0.99
R2913:9530053A07Rik UTSW 7 28164307 missense probably damaging 1.00
R3150:9530053A07Rik UTSW 7 28154195 missense probably benign 0.21
R3499:9530053A07Rik UTSW 7 28154555 missense probably benign 0.42
R3702:9530053A07Rik UTSW 7 28157778 missense probably damaging 1.00
R3881:9530053A07Rik UTSW 7 28140038 nonsense probably null
R3938:9530053A07Rik UTSW 7 28154294 missense probably damaging 1.00
R4050:9530053A07Rik UTSW 7 28152985 missense possibly damaging 0.55
R4152:9530053A07Rik UTSW 7 28156897 missense possibly damaging 0.47
R4168:9530053A07Rik UTSW 7 28137109 missense probably benign 0.05
R4235:9530053A07Rik UTSW 7 28156648 missense probably damaging 0.99
R4241:9530053A07Rik UTSW 7 28154335 missense probably damaging 1.00
R4363:9530053A07Rik UTSW 7 28146906 missense probably damaging 1.00
R4460:9530053A07Rik UTSW 7 28152856 missense probably benign 0.17
R4463:9530053A07Rik UTSW 7 28150719 missense probably benign
R4841:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4842:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4876:9530053A07Rik UTSW 7 28142800 intron probably benign
R4905:9530053A07Rik UTSW 7 28156983 missense possibly damaging 0.93
R4997:9530053A07Rik UTSW 7 28143924 missense possibly damaging 0.77
R5091:9530053A07Rik UTSW 7 28156958 missense probably benign 0.44
R5159:9530053A07Rik UTSW 7 28153308 missense probably benign 0.09
R5326:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5396:9530053A07Rik UTSW 7 28140183 missense probably benign
R5441:9530053A07Rik UTSW 7 28156914 missense probably damaging 1.00
R5480:9530053A07Rik UTSW 7 28157999 nonsense probably null
R5542:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5613:9530053A07Rik UTSW 7 28142878 intron probably benign
R5637:9530053A07Rik UTSW 7 28152852 missense probably benign 0.00
R5766:9530053A07Rik UTSW 7 28137329 nonsense probably null
R6174:9530053A07Rik UTSW 7 28139959 missense probably damaging 0.96
R6233:9530053A07Rik UTSW 7 28131460 missense probably damaging 0.99
R6250:9530053A07Rik UTSW 7 28150714 missense probably damaging 1.00
R6379:9530053A07Rik UTSW 7 28157592 missense probably damaging 1.00
R6442:9530053A07Rik UTSW 7 28144186 missense possibly damaging 0.88
R6478:9530053A07Rik UTSW 7 28155373 missense probably damaging 1.00
R6699:9530053A07Rik UTSW 7 28144368 missense probably damaging 1.00
R6852:9530053A07Rik UTSW 7 28147135 missense probably damaging 1.00
R6883:9530053A07Rik UTSW 7 28152835 missense possibly damaging 0.89
R6902:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6903:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6904:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6992:9530053A07Rik UTSW 7 28140183 missense probably benign 0.04
R7023:9530053A07Rik UTSW 7 28140038 nonsense probably null
R7039:9530053A07Rik UTSW 7 28140148 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CAGACACTTGCTTCAGAAGTAC -3'
(R):5'- TGGCACCTAACGCATAGTAGC -3'

Sequencing Primer
(F):5'- GAAGTACTCTTCAGGGTGATACACTC -3'
(R):5'- CATAGTAGCGCCCTTGGTG -3'
Posted On2016-10-24