Incidental Mutation 'R5571:Siae'
ID435675
Institutional Source Beutler Lab
Gene Symbol Siae
Ensembl Gene ENSMUSG00000001942
Gene Namesialic acid acetylesterase
SynonymsLSE, clone 165, Ysg2
MMRRC Submission 044395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5571 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location37555698-37649655 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37616923 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 64 (G64D)
Ref Sequence ENSEMBL: ENSMUSP00000149505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002007] [ENSMUST00000002013] [ENSMUST00000213126] [ENSMUST00000214786] [ENSMUST00000215474] [ENSMUST00000215829]
Predicted Effect probably benign
Transcript: ENSMUST00000002007
SMART Domains Protein: ENSMUSP00000002007
Gene: ENSMUSG00000001942

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:DUF303 118 420 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000002013
SMART Domains Protein: ENSMUSP00000002013
Gene: ENSMUSG00000001948

DomainStartEndE-ValueType
RIIa 14 51 7.04e-15 SMART
low complexity region 75 86 N/A INTRINSIC
IQ 111 133 7.4e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213126
AA Change: G29D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000214786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215336
Predicted Effect probably benign
Transcript: ENSMUST00000215474
AA Change: G64D

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215678
Predicted Effect probably benign
Transcript: ENSMUST00000215829
AA Change: G29D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217567
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which removes 9-O-acetylation modifications from sialic acids. Mutations in this gene are associated with susceptibility to autoimmune disease 6. Multiple transcript variants encoding different isoforms, found either in the cytosol or in the lysosome, have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit normal marginal zone B cell and memory phenotype T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T A 7: 140,249,123 C232S probably damaging Het
9530053A07Rik A G 7: 28,156,569 D1927G probably damaging Het
Atad5 T C 11: 80,111,556 V1058A probably benign Het
Baiap2l2 T C 15: 79,271,583 H97R probably damaging Het
Bax A G 7: 45,461,891 S184P probably damaging Het
Bsph1 T G 7: 13,450,915 M1R probably null Het
Cbln2 A G 18: 86,713,148 D27G probably benign Het
Cntnap3 G A 13: 64,903,758 A28V probably damaging Het
Col6a3 C A 1: 90,788,216 R1641L unknown Het
Dhrs3 T G 4: 144,893,564 I17S probably benign Het
Ep300 T C 15: 81,643,217 probably benign Het
Epb41 T C 4: 131,937,406 probably benign Het
Fat4 A T 3: 39,010,274 E4793V probably damaging Het
Fbxw22 T G 9: 109,403,088 K80N probably damaging Het
Fbxw24 T C 9: 109,606,998 E322G probably benign Het
Fndc7 T C 3: 108,856,408 I639V possibly damaging Het
Folh1 T C 7: 86,734,120 Y473C probably damaging Het
Foxb2 T A 19: 16,872,767 M292L probably benign Het
Gapvd1 A G 2: 34,715,253 S41P probably damaging Het
Gm8298 A T 3: 59,877,219 H371L probably damaging Het
Gmds A T 13: 31,917,721 probably null Het
Gp6 G T 7: 4,368,900 A302D probably damaging Het
Hmgcr A T 13: 96,666,663 M8K probably benign Het
Itpripl2 C T 7: 118,489,869 R489Q probably damaging Het
Kmo T C 1: 175,647,194 V175A possibly damaging Het
Lce1i C T 3: 92,777,681 G63S unknown Het
Lrp1b T C 2: 41,408,342 Q155R probably damaging Het
Mdm1 T C 10: 118,159,683 S541P possibly damaging Het
Mgea5 T C 19: 45,777,006 T121A probably benign Het
Neto2 C T 8: 85,640,544 D524N probably damaging Het
Olfr1350 T C 7: 6,570,825 I278T possibly damaging Het
Olfr183 A T 16: 59,000,206 I174L probably benign Het
Olfr319 T A 11: 58,702,051 F117I probably damaging Het
Olfr338 A G 2: 36,377,117 T114A probably benign Het
Ppp4r1 C T 17: 65,803,861 Q21* probably null Het
Ryr2 T A 13: 11,555,448 T4930S possibly damaging Het
Slc14a2 T C 18: 78,209,067 M10V possibly damaging Het
Ssrp1 C G 2: 85,044,325 D496E probably damaging Het
Steap2 A G 5: 5,675,912 S371P probably damaging Het
Taf6l G A 19: 8,783,930 R24W probably damaging Het
Tbkbp1 T C 11: 97,148,729 Q118R probably damaging Het
Tln2 C T 9: 67,334,320 G1001E possibly damaging Het
Tm2d3 A G 7: 65,699,124 N184D probably damaging Het
Tmprss2 A T 16: 97,590,871 W131R probably null Het
Ube2d2a A G 18: 35,770,478 probably benign Het
Unc13d A G 11: 116,063,654 Y1043H probably benign Het
Usp34 T A 11: 23,457,975 I2600K probably damaging Het
Vmn1r198 A G 13: 22,354,998 Y218C probably damaging Het
Vmn2r8 T C 5: 108,802,240 Y247C probably damaging Het
Wdr59 A T 8: 111,465,831 N699K probably damaging Het
Zcchc2 T C 1: 106,023,672 V579A probably benign Het
Zfhx3 A T 8: 108,955,991 Q3354L unknown Het
Other mutations in Siae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Siae APN 9 37631486 missense probably damaging 0.98
IGL02696:Siae APN 9 37631384 missense probably damaging 1.00
R0531:Siae UTSW 9 37627794 missense probably benign 0.04
R1138:Siae UTSW 9 37642692 missense probably damaging 1.00
R1748:Siae UTSW 9 37631606 critical splice donor site probably null
R2175:Siae UTSW 9 37627796 missense probably damaging 1.00
R4301:Siae UTSW 9 37633713 missense possibly damaging 0.51
R4887:Siae UTSW 9 37627800 missense possibly damaging 0.93
R4989:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5133:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5134:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5151:Siae UTSW 9 37631573 missense probably benign 0.02
R5242:Siae UTSW 9 37644852 missense probably damaging 1.00
R5459:Siae UTSW 9 37616823 missense probably damaging 1.00
R6335:Siae UTSW 9 37632981 missense probably benign 0.03
R6552:Siae UTSW 9 37646400 missense possibly damaging 0.57
R6692:Siae UTSW 9 37642799 critical splice donor site probably null
R6694:Siae UTSW 9 37616823 missense probably damaging 1.00
R7183:Siae UTSW 9 37616946 missense possibly damaging 0.77
R7266:Siae UTSW 9 37623013 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGGATCCACATGATGCTGAATC -3'
(R):5'- AGCCTTGTTACCATTTGTGGTATC -3'

Sequencing Primer
(F):5'- GATCCACATGATGCTGAATCTCCTG -3'
(R):5'- CAAATAACTCTTATGGATGGATGGG -3'
Posted On2016-10-24