Mutagenetix > Incidental Mutation

Incidental Mutation 'R5571:Ryr2'

435685

Institutional Source

Beutler Lab

Gene Symbol

Ryr2

Ensembl Gene

ENSMUSG00000021313

Gene Name

ryanodine receptor 2, cardiac

Synonyms

9330127I20Rik

MMRRC Submission

044395-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5571 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11567988-12121831 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 11570334 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 4930 (T4930S)

Ref Sequence

ENSEMBL: ENSMUSP00000127991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000021750
AA Change: T4930S

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: T4930S

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	454	648	3.1e-65	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	862	952	1.8e-36	PFAM
Pfam:RyR	976	1066	1.1e-32	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2122	2331	1.2e-71	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2700	2790	1.1e-33	PFAM
Pfam:RyR	2820	2904	7.1e-27	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3829	3947	3.1e-36	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.7e-96	PFAM
Pfam:Ion_trans	4710	4877	8e-16	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170156
AA Change: T4930S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: T4930S

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	451	655	3.5e-73	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	861	955	1.4e-33	PFAM
Pfam:RyR	975	1069	9.2e-34	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2120	2331	3.9e-65	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2699	2793	1.1e-37	PFAM
Pfam:RyR	2819	2907	9.4e-34	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3825	3958	2.3e-42	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.1e-93	PFAM
Pfam:Ion_trans	4705	4865	9.3e-11	PFAM

Meta Mutation Damage Score

0.7533

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 92.9%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]

Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl2fm3	A	T	3: 59,784,640 (GRCm39)	H371L	probably damaging	Het
Atad5	T	C	11: 80,002,382 (GRCm39)	V1058A	probably benign	Het
Baiap2l2	T	C	15: 79,155,783 (GRCm39)	H97R	probably damaging	Het
Bax	A	G	7: 45,111,315 (GRCm39)	S184P	probably damaging	Het
Bsph1	T	G	7: 13,184,840 (GRCm39)	M1R	probably null	Het
Cbln2	A	G	18: 86,731,273 (GRCm39)	D27G	probably benign	Het
Cntnap3	G	A	13: 65,051,572 (GRCm39)	A28V	probably damaging	Het
Col6a3	C	A	1: 90,715,938 (GRCm39)	R1641L	unknown	Het
Dhrs3	T	G	4: 144,620,134 (GRCm39)	I17S	probably benign	Het
Ep300	T	C	15: 81,527,418 (GRCm39)		probably benign	Het
Epb41	T	C	4: 131,664,717 (GRCm39)		probably benign	Het
Fat4	A	T	3: 39,064,423 (GRCm39)	E4793V	probably damaging	Het
Fbxw22	T	G	9: 109,232,156 (GRCm39)	K80N	probably damaging	Het
Fbxw24	T	C	9: 109,436,066 (GRCm39)	E322G	probably benign	Het
Fcgbpl1	A	G	7: 27,855,994 (GRCm39)	D1927G	probably damaging	Het
Fndc7	T	C	3: 108,763,724 (GRCm39)	I639V	possibly damaging	Het
Folh1	T	C	7: 86,383,328 (GRCm39)	Y473C	probably damaging	Het
Foxb2	T	A	19: 16,850,131 (GRCm39)	M292L	probably benign	Het
Gapvd1	A	G	2: 34,605,265 (GRCm39)	S41P	probably damaging	Het
Gmds	A	T	13: 32,101,704 (GRCm39)		probably null	Het
Gp6	G	T	7: 4,371,899 (GRCm39)	A302D	probably damaging	Het
Hmgcr	A	T	13: 96,803,171 (GRCm39)	M8K	probably benign	Het
Itpripl2	C	T	7: 118,089,092 (GRCm39)	R489Q	probably damaging	Het
Kmo	T	C	1: 175,474,760 (GRCm39)	V175A	possibly damaging	Het
Lce1i	C	T	3: 92,684,988 (GRCm39)	G63S	unknown	Het
Lrp1b	T	C	2: 41,298,354 (GRCm39)	Q155R	probably damaging	Het
Mdm1	T	C	10: 117,995,588 (GRCm39)	S541P	possibly damaging	Het
Neto2	C	T	8: 86,367,173 (GRCm39)	D524N	probably damaging	Het
Oga	T	C	19: 45,765,445 (GRCm39)	T121A	probably benign	Het
Or1j10	A	G	2: 36,267,129 (GRCm39)	T114A	probably benign	Het
Or2ak6	T	A	11: 58,592,877 (GRCm39)	F117I	probably damaging	Het
Or5bw2	T	C	7: 6,573,824 (GRCm39)	I278T	possibly damaging	Het
Or5h17	A	T	16: 58,820,569 (GRCm39)	I174L	probably benign	Het
Ppp4r1	C	T	17: 66,110,856 (GRCm39)	Q21*	probably null	Het
Scart2	T	A	7: 139,829,036 (GRCm39)	C232S	probably damaging	Het
Siae	G	A	9: 37,528,219 (GRCm39)	G64D	probably benign	Het
Slc14a2	T	C	18: 78,252,282 (GRCm39)	M10V	possibly damaging	Het
Ssrp1	C	G	2: 84,874,669 (GRCm39)	D496E	probably damaging	Het
Steap2	A	G	5: 5,725,912 (GRCm39)	S371P	probably damaging	Het
Taf6l	G	A	19: 8,761,294 (GRCm39)	R24W	probably damaging	Het
Tbkbp1	T	C	11: 97,039,555 (GRCm39)	Q118R	probably damaging	Het
Tln2	C	T	9: 67,241,602 (GRCm39)	G1001E	possibly damaging	Het
Tm2d3	A	G	7: 65,348,872 (GRCm39)	N184D	probably damaging	Het
Tmprss2	A	T	16: 97,392,071 (GRCm39)	W131R	probably null	Het
Ube2d2a	A	G	18: 35,903,531 (GRCm39)		probably benign	Het
Unc13d	A	G	11: 115,954,480 (GRCm39)	Y1043H	probably benign	Het
Usp34	T	A	11: 23,407,975 (GRCm39)	I2600K	probably damaging	Het
Vmn1r198	A	G	13: 22,539,168 (GRCm39)	Y218C	probably damaging	Het
Vmn2r8	T	C	5: 108,950,106 (GRCm39)	Y247C	probably damaging	Het
Wdr59	A	T	8: 112,192,463 (GRCm39)	N699K	probably damaging	Het
Zcchc2	T	C	1: 105,951,402 (GRCm39)	V579A	probably benign	Het
Zfhx3	A	T	8: 109,682,623 (GRCm39)	Q3354L	unknown	Het

Other mutations in Ryr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Ryr2	APN	13	11,848,978 (GRCm39)	splice site	probably benign
IGL00757:Ryr2	APN	13	11,633,490 (GRCm39)	splice site	probably null
IGL00838:Ryr2	APN	13	11,583,389 (GRCm39)	missense	probably damaging	0.98
IGL00849:Ryr2	APN	13	11,600,364 (GRCm39)	missense	possibly damaging	0.91
IGL00987:Ryr2	APN	13	11,750,388 (GRCm39)	missense	probably damaging	0.99
IGL01096:Ryr2	APN	13	11,718,430 (GRCm39)	missense	probably damaging	1.00
IGL01313:Ryr2	APN	13	11,653,371 (GRCm39)	critical splice acceptor site	probably null
IGL01349:Ryr2	APN	13	11,602,125 (GRCm39)	missense	possibly damaging	0.93
IGL01391:Ryr2	APN	13	11,571,571 (GRCm39)	missense	possibly damaging	0.96
IGL01401:Ryr2	APN	13	11,606,238 (GRCm39)	missense	possibly damaging	0.80
IGL01412:Ryr2	APN	13	11,756,922 (GRCm39)	missense	probably benign	0.10
IGL01419:Ryr2	APN	13	11,814,723 (GRCm39)	missense	possibly damaging	0.51
IGL01432:Ryr2	APN	13	11,866,090 (GRCm39)	missense	possibly damaging	0.63
IGL01533:Ryr2	APN	13	11,736,676 (GRCm39)	missense	probably damaging	1.00
IGL01571:Ryr2	APN	13	11,736,647 (GRCm39)	missense	probably damaging	1.00
IGL01584:Ryr2	APN	13	11,616,644 (GRCm39)	critical splice donor site	probably null
IGL01611:Ryr2	APN	13	11,606,202 (GRCm39)	missense	possibly damaging	0.67
IGL01632:Ryr2	APN	13	11,609,854 (GRCm39)	missense	probably damaging	0.97
IGL01643:Ryr2	APN	13	11,707,563 (GRCm39)	missense	possibly damaging	0.94
IGL01647:Ryr2	APN	13	11,600,366 (GRCm39)	missense	probably damaging	1.00
IGL01730:Ryr2	APN	13	11,616,728 (GRCm39)	missense	possibly damaging	0.86
IGL01834:Ryr2	APN	13	11,610,311 (GRCm39)	missense	possibly damaging	0.71
IGL01921:Ryr2	APN	13	11,569,436 (GRCm39)	missense	possibly damaging	0.96
IGL01937:Ryr2	APN	13	11,805,249 (GRCm39)	missense	probably damaging	1.00
IGL01945:Ryr2	APN	13	11,805,249 (GRCm39)	missense	probably damaging	1.00
IGL02027:Ryr2	APN	13	11,611,998 (GRCm39)	missense	probably damaging	1.00
IGL02060:Ryr2	APN	13	11,762,450 (GRCm39)	missense	probably damaging	1.00
IGL02065:Ryr2	APN	13	11,587,143 (GRCm39)	missense	possibly damaging	0.92
IGL02084:Ryr2	APN	13	11,807,648 (GRCm39)	nonsense	probably null
IGL02086:Ryr2	APN	13	11,750,442 (GRCm39)	missense	probably damaging	1.00
IGL02095:Ryr2	APN	13	11,774,645 (GRCm39)	missense	probably damaging	0.98
IGL02100:Ryr2	APN	13	11,752,759 (GRCm39)	missense	possibly damaging	0.92
IGL02122:Ryr2	APN	13	11,756,755 (GRCm39)	missense	probably damaging	1.00
IGL02202:Ryr2	APN	13	11,745,274 (GRCm39)	missense	probably damaging	0.97
IGL02202:Ryr2	APN	13	11,762,544 (GRCm39)	splice site	probably benign
IGL02369:Ryr2	APN	13	11,634,382 (GRCm39)	missense	possibly damaging	0.68
IGL02383:Ryr2	APN	13	11,737,607 (GRCm39)	splice site	probably benign
IGL02400:Ryr2	APN	13	11,620,130 (GRCm39)	splice site	probably benign
IGL02423:Ryr2	APN	13	11,760,084 (GRCm39)	missense	probably damaging	1.00
IGL02425:Ryr2	APN	13	11,760,560 (GRCm39)	missense	probably damaging	0.99
IGL02458:Ryr2	APN	13	11,720,585 (GRCm39)	missense	probably benign	0.15
IGL02602:Ryr2	APN	13	11,569,397 (GRCm39)	utr 3 prime	probably benign
IGL02694:Ryr2	APN	13	11,620,075 (GRCm39)	missense	probably damaging	1.00
IGL02726:Ryr2	APN	13	11,753,206 (GRCm39)	missense	probably damaging	1.00
IGL02747:Ryr2	APN	13	11,670,563 (GRCm39)	missense	probably damaging	1.00
IGL02795:Ryr2	APN	13	11,610,076 (GRCm39)	missense	probably benign	0.21
IGL02876:Ryr2	APN	13	11,722,679 (GRCm39)	missense	probably benign	0.39
IGL02878:Ryr2	APN	13	11,933,205 (GRCm39)	missense	probably benign	0.10
IGL02887:Ryr2	APN	13	11,606,155 (GRCm39)	missense	probably damaging	0.97
IGL02926:Ryr2	APN	13	11,774,721 (GRCm39)	missense	probably damaging	0.99
IGL03030:Ryr2	APN	13	11,699,365 (GRCm39)	missense	probably damaging	0.99
IGL03064:Ryr2	APN	13	11,658,788 (GRCm39)	critical splice acceptor site	probably null
IGL03102:Ryr2	APN	13	11,650,468 (GRCm39)	splice site	probably benign
IGL03152:Ryr2	APN	13	11,868,036 (GRCm39)	missense	probably damaging	1.00
IGL03176:Ryr2	APN	13	11,756,909 (GRCm39)	nonsense	probably null
IGL03180:Ryr2	APN	13	11,583,449 (GRCm39)	missense	possibly damaging	0.95
IGL03213:Ryr2	APN	13	11,739,273 (GRCm39)	splice site	probably benign
IGL03390:Ryr2	APN	13	11,787,302 (GRCm39)	missense	probably benign
IGL03410:Ryr2	APN	13	11,603,033 (GRCm39)	missense	probably damaging	0.99
Arruda	UTSW	13	11,658,781 (GRCm39)	missense	probably damaging	1.00
Arruda2	UTSW	13	11,894,382 (GRCm39)	missense	probably damaging	1.00
Arruda3	UTSW	13	11,570,334 (GRCm39)	missense	possibly damaging	0.91
barricuda	UTSW	13	11,609,900 (GRCm39)	missense	probably benign	0.06
BB006:Ryr2	UTSW	13	11,705,181 (GRCm39)	nonsense	probably null
BB006:Ryr2	UTSW	13	11,609,680 (GRCm39)	missense	probably damaging	1.00
BB016:Ryr2	UTSW	13	11,705,181 (GRCm39)	nonsense	probably null
BB016:Ryr2	UTSW	13	11,609,680 (GRCm39)	missense	probably damaging	1.00
H8562:Ryr2	UTSW	13	11,732,027 (GRCm39)	splice site	probably benign
IGL02799:Ryr2	UTSW	13	11,680,848 (GRCm39)	missense	probably damaging	1.00
IGL02991:Ryr2	UTSW	13	11,776,192 (GRCm39)	missense	probably damaging	0.99
PIT4142001:Ryr2	UTSW	13	11,722,682 (GRCm39)	missense	probably damaging	0.97
PIT4260001:Ryr2	UTSW	13	11,609,641 (GRCm39)	missense	possibly damaging	0.93
PIT4458001:Ryr2	UTSW	13	11,570,334 (GRCm39)	missense	probably benign	0.29
R0003:Ryr2	UTSW	13	11,839,265 (GRCm39)	missense	probably damaging	1.00
R0004:Ryr2	UTSW	13	11,680,805 (GRCm39)	missense	probably benign
R0018:Ryr2	UTSW	13	11,610,109 (GRCm39)	missense	possibly damaging	0.94
R0048:Ryr2	UTSW	13	11,610,670 (GRCm39)	missense	probably damaging	1.00
R0048:Ryr2	UTSW	13	11,610,670 (GRCm39)	missense	probably damaging	1.00
R0056:Ryr2	UTSW	13	11,683,924 (GRCm39)	missense	probably damaging	0.97
R0062:Ryr2	UTSW	13	11,884,002 (GRCm39)	critical splice donor site	probably null
R0062:Ryr2	UTSW	13	11,884,002 (GRCm39)	critical splice donor site	probably null
R0080:Ryr2	UTSW	13	11,583,361 (GRCm39)	missense	probably damaging	0.98
R0116:Ryr2	UTSW	13	11,724,807 (GRCm39)	missense	probably damaging	1.00
R0148:Ryr2	UTSW	13	11,729,434 (GRCm39)	missense	probably damaging	1.00
R0206:Ryr2	UTSW	13	11,691,137 (GRCm39)	splice site	probably benign
R0226:Ryr2	UTSW	13	11,787,442 (GRCm39)	missense	probably damaging	1.00
R0285:Ryr2	UTSW	13	11,731,863 (GRCm39)	missense	probably damaging	1.00
R0365:Ryr2	UTSW	13	11,683,725 (GRCm39)	missense	possibly damaging	0.90
R0401:Ryr2	UTSW	13	11,720,570 (GRCm39)	missense	probably benign	0.45
R0415:Ryr2	UTSW	13	11,884,042 (GRCm39)	missense	probably damaging	0.97
R0418:Ryr2	UTSW	13	11,848,981 (GRCm39)	splice site	probably benign
R0558:Ryr2	UTSW	13	11,814,747 (GRCm39)	missense	probably damaging	1.00
R0558:Ryr2	UTSW	13	11,653,329 (GRCm39)	missense	probably damaging	1.00
R0574:Ryr2	UTSW	13	11,746,555 (GRCm39)	missense	probably benign	0.02
R0586:Ryr2	UTSW	13	11,650,445 (GRCm39)	missense	probably null
R0601:Ryr2	UTSW	13	11,720,519 (GRCm39)	critical splice donor site	probably null
R0610:Ryr2	UTSW	13	11,637,838 (GRCm39)	missense	probably damaging	1.00
R0648:Ryr2	UTSW	13	11,739,219 (GRCm39)	missense	possibly damaging	0.86
R0727:Ryr2	UTSW	13	11,581,771 (GRCm39)	missense	probably damaging	1.00
R0743:Ryr2	UTSW	13	11,569,415 (GRCm39)	missense	probably damaging	0.99
R0821:Ryr2	UTSW	13	11,753,012 (GRCm39)	missense	probably benign	0.35
R0884:Ryr2	UTSW	13	11,569,415 (GRCm39)	missense	probably damaging	0.99
R1104:Ryr2	UTSW	13	11,684,855 (GRCm39)	missense	probably damaging	0.99
R1114:Ryr2	UTSW	13	11,960,867 (GRCm39)	missense	probably damaging	0.98
R1167:Ryr2	UTSW	13	11,674,999 (GRCm39)	missense	possibly damaging	0.94
R1238:Ryr2	UTSW	13	11,774,589 (GRCm39)	missense	probably damaging	1.00
R1239:Ryr2	UTSW	13	11,897,929 (GRCm39)	critical splice donor site	probably null
R1296:Ryr2	UTSW	13	11,702,765 (GRCm39)	splice site	probably benign
R1400:Ryr2	UTSW	13	11,609,962 (GRCm39)	missense	probably benign	0.08
R1439:Ryr2	UTSW	13	11,729,389 (GRCm39)	splice site	probably benign
R1443:Ryr2	UTSW	13	11,794,152 (GRCm39)	missense	probably benign	0.19
R1446:Ryr2	UTSW	13	11,753,035 (GRCm39)	missense	probably benign	0.09
R1458:Ryr2	UTSW	13	11,741,908 (GRCm39)	missense	probably damaging	0.97
R1497:Ryr2	UTSW	13	11,616,727 (GRCm39)	missense	probably damaging	0.99
R1505:Ryr2	UTSW	13	11,569,478 (GRCm39)	missense	possibly damaging	0.84
R1548:Ryr2	UTSW	13	11,569,435 (GRCm39)	nonsense	probably null
R1551:Ryr2	UTSW	13	11,800,029 (GRCm39)	critical splice acceptor site	probably null
R1567:Ryr2	UTSW	13	11,774,563 (GRCm39)	missense	possibly damaging	0.87
R1581:Ryr2	UTSW	13	11,809,449 (GRCm39)	missense	probably benign	0.01
R1645:Ryr2	UTSW	13	11,733,368 (GRCm39)	nonsense	probably null
R1686:Ryr2	UTSW	13	11,618,665 (GRCm39)	splice site	probably benign
R1696:Ryr2	UTSW	13	11,746,543 (GRCm39)	missense	probably benign	0.02
R1708:Ryr2	UTSW	13	11,602,328 (GRCm39)	splice site	probably null
R1728:Ryr2	UTSW	13	11,602,308 (GRCm39)	missense	possibly damaging	0.94
R1745:Ryr2	UTSW	13	11,805,153 (GRCm39)	missense	probably damaging	1.00
R1771:Ryr2	UTSW	13	11,760,062 (GRCm39)	critical splice donor site	probably null
R1776:Ryr2	UTSW	13	11,760,062 (GRCm39)	critical splice donor site	probably null
R1783:Ryr2	UTSW	13	11,715,257 (GRCm39)	nonsense	probably null
R1801:Ryr2	UTSW	13	11,610,167 (GRCm39)	missense	probably benign	0.01
R1812:Ryr2	UTSW	13	11,575,472 (GRCm39)	missense	probably damaging	0.97
R1820:Ryr2	UTSW	13	11,602,202 (GRCm39)	missense	probably damaging	0.99
R1835:Ryr2	UTSW	13	11,784,764 (GRCm39)	missense	probably benign	0.06
R1868:Ryr2	UTSW	13	11,746,586 (GRCm39)	missense	probably benign	0.02
R1869:Ryr2	UTSW	13	11,676,961 (GRCm39)	missense	probably damaging	0.98
R1884:Ryr2	UTSW	13	11,753,242 (GRCm39)	missense	probably damaging	0.97
R1892:Ryr2	UTSW	13	11,673,844 (GRCm39)	nonsense	probably null
R1897:Ryr2	UTSW	13	11,765,818 (GRCm39)	missense	probably benign	0.09
R1899:Ryr2	UTSW	13	11,606,222 (GRCm39)	missense	probably benign
R1909:Ryr2	UTSW	13	11,715,235 (GRCm39)	missense	probably damaging	1.00
R1918:Ryr2	UTSW	13	11,571,584 (GRCm39)	missense	possibly damaging	0.91
R1937:Ryr2	UTSW	13	11,683,848 (GRCm39)	missense	probably damaging	1.00
R1943:Ryr2	UTSW	13	11,746,609 (GRCm39)	missense	probably benign	0.10
R1956:Ryr2	UTSW	13	11,695,966 (GRCm39)	missense	probably damaging	1.00
R1983:Ryr2	UTSW	13	11,600,288 (GRCm39)	splice site	probably null
R2018:Ryr2	UTSW	13	11,866,074 (GRCm39)	missense	possibly damaging	0.59
R2019:Ryr2	UTSW	13	11,866,074 (GRCm39)	missense	possibly damaging	0.59
R2060:Ryr2	UTSW	13	11,610,622 (GRCm39)	missense	probably damaging	1.00
R2061:Ryr2	UTSW	13	11,680,764 (GRCm39)	splice site	probably null
R2088:Ryr2	UTSW	13	11,677,115 (GRCm39)	missense	probably benign	0.04
R2089:Ryr2	UTSW	13	11,960,863 (GRCm39)	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11,960,863 (GRCm39)	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11,960,863 (GRCm39)	missense	probably benign	0.23
R2127:Ryr2	UTSW	13	11,727,081 (GRCm39)	missense	probably damaging	1.00
R2140:Ryr2	UTSW	13	11,575,493 (GRCm39)	missense	probably damaging	1.00
R2153:Ryr2	UTSW	13	11,592,759 (GRCm39)	missense	possibly damaging	0.86
R2179:Ryr2	UTSW	13	11,720,679 (GRCm39)	nonsense	probably null
R2207:Ryr2	UTSW	13	11,825,823 (GRCm39)	missense	probably damaging	1.00
R2237:Ryr2	UTSW	13	11,677,146 (GRCm39)	missense	probably benign	0.18
R2258:Ryr2	UTSW	13	11,753,102 (GRCm39)	missense	possibly damaging	0.94
R2312:Ryr2	UTSW	13	11,753,128 (GRCm39)	missense	probably damaging	1.00
R2421:Ryr2	UTSW	13	11,606,123 (GRCm39)	missense	probably damaging	0.98
R2438:Ryr2	UTSW	13	11,816,734 (GRCm39)	missense	probably damaging	1.00
R2483:Ryr2	UTSW	13	11,774,589 (GRCm39)	missense	probably damaging	1.00
R2860:Ryr2	UTSW	13	11,607,979 (GRCm39)	missense	probably damaging	0.98
R2861:Ryr2	UTSW	13	11,607,979 (GRCm39)	missense	probably damaging	0.98
R2867:Ryr2	UTSW	13	11,776,235 (GRCm39)	missense	probably damaging	1.00
R2867:Ryr2	UTSW	13	11,776,235 (GRCm39)	missense	probably damaging	1.00
R3618:Ryr2	UTSW	13	11,787,466 (GRCm39)	critical splice acceptor site	probably null
R3876:Ryr2	UTSW	13	11,603,045 (GRCm39)	missense	probably damaging	0.99
R3906:Ryr2	UTSW	13	11,753,095 (GRCm39)	missense	possibly damaging	0.87
R3912:Ryr2	UTSW	13	11,787,313 (GRCm39)	missense	probably damaging	0.99
R4018:Ryr2	UTSW	13	11,933,300 (GRCm39)	missense	probably damaging	1.00
R4114:Ryr2	UTSW	13	11,707,568 (GRCm39)	missense	probably damaging	1.00
R4119:Ryr2	UTSW	13	11,794,153 (GRCm39)	missense	probably benign	0.22
R4127:Ryr2	UTSW	13	11,602,323 (GRCm39)	missense	possibly damaging	0.91
R4222:Ryr2	UTSW	13	11,752,759 (GRCm39)	missense	possibly damaging	0.92
R4233:Ryr2	UTSW	13	11,765,611 (GRCm39)	missense	probably benign	0.20
R4355:Ryr2	UTSW	13	11,664,698 (GRCm39)	missense	probably benign	0.05
R4384:Ryr2	UTSW	13	11,620,119 (GRCm39)	missense	probably damaging	0.99
R4422:Ryr2	UTSW	13	11,731,952 (GRCm39)	nonsense	probably null
R4430:Ryr2	UTSW	13	11,750,413 (GRCm39)	missense	probably damaging	0.98
R4624:Ryr2	UTSW	13	12,121,301 (GRCm39)	missense	possibly damaging	0.47
R4663:Ryr2	UTSW	13	11,764,395 (GRCm39)	missense	possibly damaging	0.47
R4665:Ryr2	UTSW	13	11,765,571 (GRCm39)	splice site	probably null
R4668:Ryr2	UTSW	13	11,608,003 (GRCm39)	missense	probably benign
R4677:Ryr2	UTSW	13	11,721,553 (GRCm39)	missense	probably damaging	0.98
R4679:Ryr2	UTSW	13	11,839,255 (GRCm39)	missense	probably benign	0.34
R4680:Ryr2	UTSW	13	11,610,119 (GRCm39)	missense	probably benign	0.04
R4685:Ryr2	UTSW	13	11,707,532 (GRCm39)	missense	probably damaging	1.00
R4709:Ryr2	UTSW	13	11,731,884 (GRCm39)	missense	probably damaging	1.00
R4731:Ryr2	UTSW	13	11,592,795 (GRCm39)	missense	possibly damaging	0.53
R4732:Ryr2	UTSW	13	11,592,795 (GRCm39)	missense	possibly damaging	0.53
R4733:Ryr2	UTSW	13	11,592,795 (GRCm39)	missense	possibly damaging	0.53
R4734:Ryr2	UTSW	13	11,752,639 (GRCm39)	missense	probably damaging	0.99
R4740:Ryr2	UTSW	13	11,671,933 (GRCm39)	missense	possibly damaging	0.95
R4801:Ryr2	UTSW	13	11,723,113 (GRCm39)	missense	probably damaging	1.00
R4801:Ryr2	UTSW	13	11,702,818 (GRCm39)	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11,702,818 (GRCm39)	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11,723,113 (GRCm39)	missense	probably damaging	1.00
R4804:Ryr2	UTSW	13	11,731,983 (GRCm39)	missense	probably damaging	1.00
R4811:Ryr2	UTSW	13	11,670,584 (GRCm39)	missense	probably damaging	0.97
R4850:Ryr2	UTSW	13	11,760,638 (GRCm39)	missense	probably damaging	1.00
R4850:Ryr2	UTSW	13	11,683,706 (GRCm39)	missense	probably damaging	0.99
R4880:Ryr2	UTSW	13	11,767,104 (GRCm39)	missense	probably damaging	1.00
R4917:Ryr2	UTSW	13	11,609,872 (GRCm39)	missense	probably damaging	0.96
R4918:Ryr2	UTSW	13	11,609,872 (GRCm39)	missense	probably damaging	0.96
R4922:Ryr2	UTSW	13	11,724,849 (GRCm39)	missense	probably damaging	0.99
R4933:Ryr2	UTSW	13	11,960,831 (GRCm39)	missense	probably damaging	0.96
R4950:Ryr2	UTSW	13	11,756,897 (GRCm39)	missense	probably damaging	1.00
R4957:Ryr2	UTSW	13	11,799,966 (GRCm39)	missense	probably damaging	0.97
R4964:Ryr2	UTSW	13	11,848,878 (GRCm39)	missense	probably benign	0.00
R4964:Ryr2	UTSW	13	11,729,497 (GRCm39)	missense	possibly damaging	0.49
R4966:Ryr2	UTSW	13	11,729,497 (GRCm39)	missense	possibly damaging	0.49
R4966:Ryr2	UTSW	13	11,848,878 (GRCm39)	missense	probably benign	0.00
R4997:Ryr2	UTSW	13	11,610,192 (GRCm39)	missense	probably benign	0.09
R4998:Ryr2	UTSW	13	11,658,781 (GRCm39)	missense	probably damaging	1.00
R5033:Ryr2	UTSW	13	11,602,140 (GRCm39)	missense	possibly damaging	0.93
R5061:Ryr2	UTSW	13	11,650,422 (GRCm39)	missense	possibly damaging	0.74
R5062:Ryr2	UTSW	13	11,715,240 (GRCm39)	missense	probably damaging	0.97
R5088:Ryr2	UTSW	13	11,727,129 (GRCm39)	nonsense	probably null
R5135:Ryr2	UTSW	13	11,677,016 (GRCm39)	missense	probably benign	0.05
R5138:Ryr2	UTSW	13	11,675,175 (GRCm39)	missense	probably damaging	1.00
R5168:Ryr2	UTSW	13	11,767,207 (GRCm39)	missense	probably benign
R5187:Ryr2	UTSW	13	11,787,338 (GRCm39)	missense	probably damaging	0.99
R5197:Ryr2	UTSW	13	11,653,316 (GRCm39)	critical splice donor site	probably null
R5262:Ryr2	UTSW	13	11,787,323 (GRCm39)	missense	probably damaging	0.99
R5325:Ryr2	UTSW	13	11,705,249 (GRCm39)	missense	probably damaging	0.97
R5381:Ryr2	UTSW	13	11,571,544 (GRCm39)	missense	probably damaging	1.00
R5437:Ryr2	UTSW	13	11,670,599 (GRCm39)	missense	probably damaging	1.00
R5477:Ryr2	UTSW	13	11,720,542 (GRCm39)	missense	probably damaging	1.00
R5497:Ryr2	UTSW	13	11,720,587 (GRCm39)	missense	probably null	0.15
R5509:Ryr2	UTSW	13	11,760,487 (GRCm39)	missense	probably damaging	0.98
R5518:Ryr2	UTSW	13	11,702,795 (GRCm39)	missense	probably benign	0.01
R5591:Ryr2	UTSW	13	11,609,900 (GRCm39)	missense	probably benign	0.06
R5619:Ryr2	UTSW	13	11,723,088 (GRCm39)	missense	probably damaging	1.00
R5630:Ryr2	UTSW	13	11,616,691 (GRCm39)	missense	probably damaging	1.00
R5644:Ryr2	UTSW	13	11,610,468 (GRCm39)	missense	probably damaging	0.99
R5667:Ryr2	UTSW	13	11,774,722 (GRCm39)	missense	probably damaging	1.00
R5775:Ryr2	UTSW	13	11,784,848 (GRCm39)	missense	probably damaging	1.00
R5836:Ryr2	UTSW	13	11,618,618 (GRCm39)	missense	probably damaging	1.00
R5858:Ryr2	UTSW	13	11,575,460 (GRCm39)	missense	probably damaging	0.99
R5934:Ryr2	UTSW	13	11,599,040 (GRCm39)	missense	probably damaging	0.96
R5939:Ryr2	UTSW	13	11,805,218 (GRCm39)	missense	probably damaging	0.99
R5941:Ryr2	UTSW	13	11,702,788 (GRCm39)	missense	probably damaging	1.00
R5945:Ryr2	UTSW	13	11,675,008 (GRCm39)	missense	probably damaging	1.00
R5946:Ryr2	UTSW	13	11,741,839 (GRCm39)	missense	probably damaging	1.00
R5966:Ryr2	UTSW	13	11,677,124 (GRCm39)	nonsense	probably null
R5974:Ryr2	UTSW	13	11,729,397 (GRCm39)	splice site	probably null
R6104:Ryr2	UTSW	13	11,814,711 (GRCm39)	missense	probably damaging	1.00
R6118:Ryr2	UTSW	13	11,807,575 (GRCm39)	missense	possibly damaging	0.69
R6149:Ryr2	UTSW	13	11,683,903 (GRCm39)	missense	probably benign
R6208:Ryr2	UTSW	13	11,910,106 (GRCm39)	missense	probably benign	0.04
R6217:Ryr2	UTSW	13	11,848,964 (GRCm39)	missense	probably damaging	1.00
R6230:Ryr2	UTSW	13	11,674,993 (GRCm39)	missense	probably damaging	0.99
R6279:Ryr2	UTSW	13	11,695,885 (GRCm39)	missense	probably damaging	0.97
R6294:Ryr2	UTSW	13	11,894,382 (GRCm39)	missense	probably damaging	1.00
R6300:Ryr2	UTSW	13	11,695,885 (GRCm39)	missense	probably damaging	0.97
R6350:Ryr2	UTSW	13	11,776,282 (GRCm39)	missense	probably damaging	0.98
R6484:Ryr2	UTSW	13	11,677,269 (GRCm39)	missense	possibly damaging	0.90
R6489:Ryr2	UTSW	13	11,848,893 (GRCm39)	missense	probably benign	0.29
R6548:Ryr2	UTSW	13	11,683,707 (GRCm39)	missense	probably damaging	1.00
R6591:Ryr2	UTSW	13	11,609,609 (GRCm39)	missense	probably benign	0.01
R6623:Ryr2	UTSW	13	11,724,951 (GRCm39)	missense	probably damaging	1.00
R6649:Ryr2	UTSW	13	11,610,529 (GRCm39)	missense	probably damaging	0.99
R6691:Ryr2	UTSW	13	11,609,609 (GRCm39)	missense	probably benign	0.01
R6770:Ryr2	UTSW	13	11,753,348 (GRCm39)	missense	probably damaging	1.00
R6802:Ryr2	UTSW	13	11,701,852 (GRCm39)	missense	probably damaging	1.00
R6809:Ryr2	UTSW	13	11,741,816 (GRCm39)	missense	probably damaging	1.00
R6893:Ryr2	UTSW	13	11,844,540 (GRCm39)	missense	possibly damaging	0.75
R6911:Ryr2	UTSW	13	11,842,445 (GRCm39)	missense	possibly damaging	0.50
R6915:Ryr2	UTSW	13	11,760,487 (GRCm39)	missense	probably damaging	1.00
R6943:Ryr2	UTSW	13	11,581,834 (GRCm39)	missense	possibly damaging	0.92
R6960:Ryr2	UTSW	13	11,816,129 (GRCm39)	missense	probably benign	0.28
R6997:Ryr2	UTSW	13	11,669,266 (GRCm39)	missense	possibly damaging	0.88
R6998:Ryr2	UTSW	13	11,727,052 (GRCm39)	missense	probably damaging	0.99
R7001:Ryr2	UTSW	13	11,809,491 (GRCm39)	missense	probably damaging	0.98
R7047:Ryr2	UTSW	13	11,839,286 (GRCm39)	missense	possibly damaging	0.64
R7089:Ryr2	UTSW	13	11,664,662 (GRCm39)	missense	probably benign	0.10
R7125:Ryr2	UTSW	13	11,684,873 (GRCm39)	missense	probably damaging	0.99
R7127:Ryr2	UTSW	13	11,670,599 (GRCm39)	missense	probably damaging	1.00
R7131:Ryr2	UTSW	13	11,683,697 (GRCm39)	critical splice donor site	probably null
R7131:Ryr2	UTSW	13	11,655,213 (GRCm39)	missense	possibly damaging	0.63
R7159:Ryr2	UTSW	13	11,825,794 (GRCm39)	missense	probably damaging	0.99
R7174:Ryr2	UTSW	13	11,816,063 (GRCm39)	missense	possibly damaging	0.81
R7180:Ryr2	UTSW	13	11,701,864 (GRCm39)	missense	probably damaging	1.00
R7182:Ryr2	UTSW	13	11,774,643 (GRCm39)	missense	probably benign
R7189:Ryr2	UTSW	13	11,898,009 (GRCm39)	missense	probably damaging	1.00
R7241:Ryr2	UTSW	13	11,680,799 (GRCm39)	missense	possibly damaging	0.71
R7244:Ryr2	UTSW	13	11,612,032 (GRCm39)	missense	probably damaging	1.00
R7326:Ryr2	UTSW	13	11,753,080 (GRCm39)	missense	possibly damaging	0.95
R7331:Ryr2	UTSW	13	11,760,517 (GRCm39)	missense	probably benign
R7365:Ryr2	UTSW	13	11,655,161 (GRCm39)	missense	probably damaging	0.99
R7372:Ryr2	UTSW	13	11,695,885 (GRCm39)	missense	probably damaging	0.97
R7395:Ryr2	UTSW	13	11,799,997 (GRCm39)	missense	probably damaging	0.98
R7404:Ryr2	UTSW	13	11,750,506 (GRCm39)	missense	probably damaging	0.97
R7417:Ryr2	UTSW	13	11,571,634 (GRCm39)	splice site	probably null
R7425:Ryr2	UTSW	13	11,720,530 (GRCm39)	missense	probably benign	0.20
R7444:Ryr2	UTSW	13	11,570,349 (GRCm39)	missense	probably benign	0.25
R7456:Ryr2	UTSW	13	11,767,168 (GRCm39)	missense	probably benign
R7460:Ryr2	UTSW	13	11,720,596 (GRCm39)	missense	probably benign	0.10
R7474:Ryr2	UTSW	13	11,609,762 (GRCm39)	missense	probably benign	0.04
R7543:Ryr2	UTSW	13	11,653,317 (GRCm39)	critical splice donor site	probably null
R7549:Ryr2	UTSW	13	11,752,871 (GRCm39)	missense	probably benign	0.15
R7558:Ryr2	UTSW	13	11,814,711 (GRCm39)	missense	probably damaging	1.00
R7565:Ryr2	UTSW	13	11,575,539 (GRCm39)	missense	possibly damaging	0.84
R7627:Ryr2	UTSW	13	11,776,213 (GRCm39)	missense	possibly damaging	0.65
R7698:Ryr2	UTSW	13	11,776,201 (GRCm39)	missense	possibly damaging	0.94
R7702:Ryr2	UTSW	13	11,705,219 (GRCm39)	missense	probably damaging	0.99
R7719:Ryr2	UTSW	13	11,745,229 (GRCm39)	missense	possibly damaging	0.94
R7772:Ryr2	UTSW	13	11,765,897 (GRCm39)	missense	probably benign
R7797:Ryr2	UTSW	13	11,816,066 (GRCm39)	missense	probably damaging	0.99
R7829:Ryr2	UTSW	13	11,842,493 (GRCm39)	missense	possibly damaging	0.81
R7855:Ryr2	UTSW	13	11,721,509 (GRCm39)	nonsense	probably null
R7872:Ryr2	UTSW	13	11,610,610 (GRCm39)	missense	probably damaging	1.00
R7908:Ryr2	UTSW	13	11,807,634 (GRCm39)	missense	probably benign	0.01
R7929:Ryr2	UTSW	13	11,609,680 (GRCm39)	missense	probably damaging	1.00
R7929:Ryr2	UTSW	13	11,705,181 (GRCm39)	nonsense	probably null
R7952:Ryr2	UTSW	13	11,661,313 (GRCm39)	splice site	probably null
R8008:Ryr2	UTSW	13	11,671,980 (GRCm39)	missense	probably benign	0.30
R8011:Ryr2	UTSW	13	11,603,026 (GRCm39)	critical splice donor site	probably null
R8097:Ryr2	UTSW	13	11,960,881 (GRCm39)	missense	probably damaging	0.98
R8133:Ryr2	UTSW	13	11,618,584 (GRCm39)	missense	probably damaging	1.00
R8253:Ryr2	UTSW	13	11,842,439 (GRCm39)	missense	possibly damaging	0.94
R8278:Ryr2	UTSW	13	11,610,392 (GRCm39)	nonsense	probably null
R8351:Ryr2	UTSW	13	11,814,718 (GRCm39)	missense	probably damaging	0.98
R8401:Ryr2	UTSW	13	11,683,821 (GRCm39)	missense	possibly damaging	0.95
R8403:Ryr2	UTSW	13	11,699,364 (GRCm39)	missense	possibly damaging	0.95
R8431:Ryr2	UTSW	13	11,673,894 (GRCm39)	missense	probably benign	0.00
R8509:Ryr2	UTSW	13	11,592,664 (GRCm39)	critical splice donor site	probably null
R8551:Ryr2	UTSW	13	11,575,479 (GRCm39)	missense	possibly damaging	0.93
R8684:Ryr2	UTSW	13	11,702,875 (GRCm39)	missense	probably damaging	0.99
R8735:Ryr2	UTSW	13	11,701,833 (GRCm39)	missense	probably damaging	0.97
R8766:Ryr2	UTSW	13	11,683,855 (GRCm39)	missense	probably damaging	0.97
R8817:Ryr2	UTSW	13	11,750,509 (GRCm39)	missense	possibly damaging	0.95
R8827:Ryr2	UTSW	13	11,572,934 (GRCm39)	missense	possibly damaging	0.80
R8884:Ryr2	UTSW	13	11,794,152 (GRCm39)	missense	probably benign	0.19
R8889:Ryr2	UTSW	13	11,799,990 (GRCm39)	missense	probably damaging	0.99
R8891:Ryr2	UTSW	13	11,814,768 (GRCm39)	missense	probably damaging	1.00
R8979:Ryr2	UTSW	13	11,609,924 (GRCm39)	missense	probably benign	0.00
R9013:Ryr2	UTSW	13	11,618,618 (GRCm39)	missense	probably damaging	0.98
R9040:Ryr2	UTSW	13	11,609,672 (GRCm39)	missense	probably damaging	0.97
R9044:Ryr2	UTSW	13	11,752,989 (GRCm39)	nonsense	probably null
R9056:Ryr2	UTSW	13	11,610,817 (GRCm39)	missense	possibly damaging	0.94
R9084:Ryr2	UTSW	13	11,616,724 (GRCm39)	missense	probably damaging	1.00
R9113:Ryr2	UTSW	13	11,618,741 (GRCm39)	intron	probably benign
R9116:Ryr2	UTSW	13	11,587,185 (GRCm39)	missense	possibly damaging	0.93
R9125:Ryr2	UTSW	13	11,669,292 (GRCm39)	missense	probably benign	0.28
R9148:Ryr2	UTSW	13	11,900,424 (GRCm39)	missense	probably benign	0.02
R9210:Ryr2	UTSW	13	11,844,560 (GRCm39)	missense	probably damaging	0.99
R9212:Ryr2	UTSW	13	11,844,560 (GRCm39)	missense	probably damaging	0.99
R9233:Ryr2	UTSW	13	11,610,772 (GRCm39)	missense	possibly damaging	0.77
R9254:Ryr2	UTSW	13	11,898,002 (GRCm39)	missense	probably damaging	1.00
R9262:Ryr2	UTSW	13	11,765,854 (GRCm39)	missense	probably damaging	0.97
R9275:Ryr2	UTSW	13	11,897,976 (GRCm39)	missense	probably benign	0.10
R9278:Ryr2	UTSW	13	11,897,976 (GRCm39)	missense	probably benign	0.10
R9309:Ryr2	UTSW	13	11,721,578 (GRCm39)	missense	probably damaging	0.99
R9379:Ryr2	UTSW	13	11,898,002 (GRCm39)	missense	probably damaging	1.00
R9409:Ryr2	UTSW	13	11,695,973 (GRCm39)	missense	probably damaging	0.99
R9429:Ryr2	UTSW	13	11,809,459 (GRCm39)	missense	probably damaging	0.97
R9445:Ryr2	UTSW	13	11,787,463 (GRCm39)	missense	probably damaging	1.00
R9464:Ryr2	UTSW	13	11,752,680 (GRCm39)	missense	probably benign	0.00
R9467:Ryr2	UTSW	13	11,571,490 (GRCm39)	missense	possibly damaging	0.70
R9546:Ryr2	UTSW	13	11,602,101 (GRCm39)	critical splice donor site	probably null
R9562:Ryr2	UTSW	13	11,760,104 (GRCm39)	missense	probably damaging	1.00
R9609:Ryr2	UTSW	13	11,683,848 (GRCm39)	missense	probably damaging	1.00
R9704:Ryr2	UTSW	13	11,737,646 (GRCm39)	missense	probably damaging	1.00
R9764:Ryr2	UTSW	13	11,701,935 (GRCm39)	missense	possibly damaging	0.67
R9772:Ryr2	UTSW	13	11,609,785 (GRCm39)	missense	probably benign	0.13
R9776:Ryr2	UTSW	13	11,707,599 (GRCm39)	missense	probably damaging	0.98
S24628:Ryr2	UTSW	13	11,884,042 (GRCm39)	missense	probably damaging	0.97
X0019:Ryr2	UTSW	13	11,718,387 (GRCm39)	missense	probably benign	0.04
Z1176:Ryr2	UTSW	13	11,658,689 (GRCm39)	critical splice donor site	probably null
Z1176:Ryr2	UTSW	13	11,613,497 (GRCm39)	critical splice acceptor site	probably null
Z1176:Ryr2	UTSW	13	11,809,435 (GRCm39)	nonsense	probably null
Z1177:Ryr2	UTSW	13	11,765,759 (GRCm39)	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- CCAGAAGGGGAATTTCAAATTTTCC -3'
(R):5'- AGGCCATCTCAGAGAACATGC -3'

Sequencing Primer
(F):5'- CACTGGTGGTTGTAAGCTACCC -3'
(R):5'- GCCATCTCAGAGAACATGCTTATTTC -3'

Posted On

2016-10-24