Incidental Mutation 'R5571:Foxb2'
ID435698
Institutional Source Beutler Lab
Gene Symbol Foxb2
Ensembl Gene ENSMUSG00000056829
Gene Nameforkhead box B2
SynonymsFkh4
MMRRC Submission 044395-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock #R5571 (G1)
Quality Score122
Status Validated
Chromosome19
Chromosomal Location16872316-16873830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16872767 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 292 (M292L)
Ref Sequence ENSEMBL: ENSMUSP00000072687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072915]
Predicted Effect probably benign
Transcript: ENSMUST00000072915
AA Change: M292L

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072687
Gene: ENSMUSG00000056829
AA Change: M292L

DomainStartEndE-ValueType
FH 11 101 1.5e-59 SMART
low complexity region 102 113 N/A INTRINSIC
low complexity region 137 173 N/A INTRINSIC
low complexity region 179 211 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
low complexity region 365 384 N/A INTRINSIC
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.9%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T A 7: 140,249,123 C232S probably damaging Het
9530053A07Rik A G 7: 28,156,569 D1927G probably damaging Het
Atad5 T C 11: 80,111,556 V1058A probably benign Het
Baiap2l2 T C 15: 79,271,583 H97R probably damaging Het
Bax A G 7: 45,461,891 S184P probably damaging Het
Bsph1 T G 7: 13,450,915 M1R probably null Het
Cbln2 A G 18: 86,713,148 D27G probably benign Het
Cntnap3 G A 13: 64,903,758 A28V probably damaging Het
Col6a3 C A 1: 90,788,216 R1641L unknown Het
Dhrs3 T G 4: 144,893,564 I17S probably benign Het
Ep300 T C 15: 81,643,217 probably benign Het
Epb41 T C 4: 131,937,406 probably benign Het
Fat4 A T 3: 39,010,274 E4793V probably damaging Het
Fbxw22 T G 9: 109,403,088 K80N probably damaging Het
Fbxw24 T C 9: 109,606,998 E322G probably benign Het
Fndc7 T C 3: 108,856,408 I639V possibly damaging Het
Folh1 T C 7: 86,734,120 Y473C probably damaging Het
Gapvd1 A G 2: 34,715,253 S41P probably damaging Het
Gm8298 A T 3: 59,877,219 H371L probably damaging Het
Gmds A T 13: 31,917,721 probably null Het
Gp6 G T 7: 4,368,900 A302D probably damaging Het
Hmgcr A T 13: 96,666,663 M8K probably benign Het
Itpripl2 C T 7: 118,489,869 R489Q probably damaging Het
Kmo T C 1: 175,647,194 V175A possibly damaging Het
Lce1i C T 3: 92,777,681 G63S unknown Het
Lrp1b T C 2: 41,408,342 Q155R probably damaging Het
Mdm1 T C 10: 118,159,683 S541P possibly damaging Het
Mgea5 T C 19: 45,777,006 T121A probably benign Het
Neto2 C T 8: 85,640,544 D524N probably damaging Het
Olfr1350 T C 7: 6,570,825 I278T possibly damaging Het
Olfr183 A T 16: 59,000,206 I174L probably benign Het
Olfr319 T A 11: 58,702,051 F117I probably damaging Het
Olfr338 A G 2: 36,377,117 T114A probably benign Het
Ppp4r1 C T 17: 65,803,861 Q21* probably null Het
Ryr2 T A 13: 11,555,448 T4930S possibly damaging Het
Siae G A 9: 37,616,923 G64D probably benign Het
Slc14a2 T C 18: 78,209,067 M10V possibly damaging Het
Ssrp1 C G 2: 85,044,325 D496E probably damaging Het
Steap2 A G 5: 5,675,912 S371P probably damaging Het
Taf6l G A 19: 8,783,930 R24W probably damaging Het
Tbkbp1 T C 11: 97,148,729 Q118R probably damaging Het
Tln2 C T 9: 67,334,320 G1001E possibly damaging Het
Tm2d3 A G 7: 65,699,124 N184D probably damaging Het
Tmprss2 A T 16: 97,590,871 W131R probably null Het
Ube2d2a A G 18: 35,770,478 probably benign Het
Unc13d A G 11: 116,063,654 Y1043H probably benign Het
Usp34 T A 11: 23,457,975 I2600K probably damaging Het
Vmn1r198 A G 13: 22,354,998 Y218C probably damaging Het
Vmn2r8 T C 5: 108,802,240 Y247C probably damaging Het
Wdr59 A T 8: 111,465,831 N699K probably damaging Het
Zcchc2 T C 1: 106,023,672 V579A probably benign Het
Zfhx3 A T 8: 108,955,991 Q3354L unknown Het
Other mutations in Foxb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Foxb2 APN 19 16873544 missense unknown
R0518:Foxb2 UTSW 19 16872456 nonsense probably null
R0521:Foxb2 UTSW 19 16872456 nonsense probably null
R1512:Foxb2 UTSW 19 16872514 missense probably damaging 0.98
R2352:Foxb2 UTSW 19 16873069 missense unknown
R2419:Foxb2 UTSW 19 16872961 missense probably damaging 0.96
R6747:Foxb2 UTSW 19 16872833 nonsense probably null
R6935:Foxb2 UTSW 19 16872619 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GAATGCACCAACACCGAGTGTAG -3'
(R):5'- TGCCCTATTTCCACCAGCAG -3'

Sequencing Primer
(F):5'- CAACACCGAGTGTAGGGAGCTC -3'
(R):5'- TCCCATCCCGGCAAGATG -3'
Posted On2016-10-24