Incidental Mutation 'R5572:Col17a1'
ID435756
Institutional Source Beutler Lab
Gene Symbol Col17a1
Ensembl Gene ENSMUSG00000025064
Gene Namecollagen, type XVII, alpha 1
SynonymsBP180, Bpag2, BPAg2, Bpag
MMRRC Submission 043266-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R5572 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47646344-47692094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47650729 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1126 (S1126T)
Ref Sequence ENSEMBL: ENSMUSP00000084141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026045] [ENSMUST00000086923]
Predicted Effect probably benign
Transcript: ENSMUST00000026045
AA Change: S1126T

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026045
Gene: ENSMUSG00000025064
AA Change: S1126T

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 317 335 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
Pfam:Collagen 570 631 3.2e-10 PFAM
low complexity region 634 651 N/A INTRINSIC
low complexity region 657 693 N/A INTRINSIC
internal_repeat_4 695 714 1.12e-5 PROSPERO
internal_repeat_3 695 723 3.81e-6 PROSPERO
internal_repeat_1 709 735 1.93e-9 PROSPERO
internal_repeat_4 719 738 1.12e-5 PROSPERO
Pfam:Collagen 753 816 1.3e-10 PFAM
Pfam:Collagen 825 871 5.9e-9 PFAM
low complexity region 889 927 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 981 999 N/A INTRINSIC
low complexity region 1024 1034 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1091 1113 N/A INTRINSIC
low complexity region 1126 1147 N/A INTRINSIC
low complexity region 1165 1177 N/A INTRINSIC
low complexity region 1201 1217 N/A INTRINSIC
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1275 1337 N/A INTRINSIC
low complexity region 1375 1385 N/A INTRINSIC
Pfam:Collagen 1408 1462 3.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086923
AA Change: S1126T

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000084141
Gene: ENSMUSG00000025064
AA Change: S1126T

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 317 335 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
Pfam:Collagen 570 631 3.1e-10 PFAM
Pfam:Collagen 647 726 5.2e-7 PFAM
Pfam:Collagen 699 772 1.8e-9 PFAM
Pfam:Collagen 753 816 1.3e-10 PFAM
Pfam:Collagen 825 871 5.9e-9 PFAM
low complexity region 889 927 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 981 999 N/A INTRINSIC
low complexity region 1024 1034 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1091 1113 N/A INTRINSIC
low complexity region 1126 1147 N/A INTRINSIC
low complexity region 1164 1180 N/A INTRINSIC
low complexity region 1215 1229 N/A INTRINSIC
low complexity region 1238 1300 N/A INTRINSIC
low complexity region 1338 1348 N/A INTRINSIC
Pfam:Collagen 1371 1425 3.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151102
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are unable to reproduce and display postnatal growth retardation, blisters and erosion at sites of trauma, nonpigmented hair growth associated with hair loss, subepidermal blistering associated with poorly formed hemidesmosomes, and high postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A T 11: 78,264,567 D167V probably damaging Het
Abcb1a C T 5: 8,715,108 probably null Het
Abcd4 T C 12: 84,606,276 D380G probably benign Het
Actr3b T A 5: 25,809,888 D68E probably benign Het
Apol10a T C 15: 77,488,634 S157P probably damaging Het
Arap3 A T 18: 37,991,066 I327N probably damaging Het
Arnt G T 3: 95,474,704 V198L possibly damaging Het
Baiap3 T A 17: 25,251,475 D86V possibly damaging Het
Bcl9l G T 9: 44,500,798 R27L possibly damaging Het
C1qc T C 4: 136,892,462 Y34C probably benign Het
C1rb T C 6: 124,580,799 S632P probably benign Het
C3 A G 17: 57,224,673 S284P probably damaging Het
Cfap44 T G 16: 44,481,305 V1802G possibly damaging Het
Cfhr1 A G 1: 139,556,427 V117A possibly damaging Het
Clca3b T C 3: 144,827,309 D654G probably damaging Het
Cts3 T A 13: 61,564,968 I313F probably damaging Het
Egfl7 T C 2: 26,591,691 V6A possibly damaging Het
Eif2s3y G A Y: 1,016,631 D272N probably damaging Het
Fam129a T C 1: 151,709,190 S513P probably benign Het
Foxp4 A G 17: 47,880,879 V111A unknown Het
Hmcn2 A T 2: 31,414,525 probably null Het
Hmcn2 G A 2: 31,414,526 probably null Het
Igsf11 C T 16: 39,024,932 R283C probably damaging Het
Il1a A G 2: 129,307,918 Y21H possibly damaging Het
Il6ra A T 3: 89,871,282 V420D probably damaging Het
Kdm5a T C 6: 120,412,375 V921A possibly damaging Het
Kirrel3 G A 9: 35,000,948 A196T probably damaging Het
Klra1 T A 6: 130,372,839 D212V possibly damaging Het
N4bp2l2 G A 5: 150,662,290 T75I probably benign Het
Nnmt A G 9: 48,592,147 L193P probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Ntm A G 9: 29,014,216 I191T probably damaging Het
Olfr318 A G 11: 58,720,229 V273A probably benign Het
Olfr607 A C 7: 103,460,698 L170R probably benign Het
Olfr652 A T 7: 104,564,994 T258S probably benign Het
Pam A C 1: 97,854,744 probably benign Het
Pomk T A 8: 25,983,190 H245L possibly damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rasip1 G T 7: 45,636,729 R792L probably benign Het
Ret T C 6: 118,155,431 Y1016C probably damaging Het
Rhbdd1 A T 1: 82,340,810 N138I possibly damaging Het
Snx13 T G 12: 35,103,120 V383G probably damaging Het
Syt3 A G 7: 44,390,718 H125R probably benign Het
Tlr6 A T 5: 64,955,018 L182Q probably damaging Het
Tlr9 T C 9: 106,225,637 V709A possibly damaging Het
Tmprss6 T C 15: 78,442,422 Y655C probably damaging Het
Ttn A T 2: 76,853,628 probably benign Het
Ube3a T C 7: 59,288,777 I761T probably damaging Het
Ube3b G A 5: 114,406,179 D546N probably damaging Het
Ugt2b36 A G 5: 87,089,482 V188A possibly damaging Het
Usp29 A G 7: 6,962,192 I345V probably benign Het
Vmn2r78 A G 7: 86,915,512 K55R probably benign Het
Wdsub1 A G 2: 59,862,707 F288L possibly damaging Het
Zan C T 5: 137,394,431 V4601M unknown Het
Zbtb8b T C 4: 129,428,541 K376E probably damaging Het
Zfp619 A T 7: 39,535,239 Y231F probably benign Het
Other mutations in Col17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Col17a1 APN 19 47681403 missense probably damaging 1.00
IGL01620:Col17a1 APN 19 47668539 missense possibly damaging 0.81
IGL02149:Col17a1 APN 19 47668632 missense probably benign 0.01
IGL02176:Col17a1 APN 19 47651219 missense probably benign 0.02
IGL03352:Col17a1 APN 19 47681375 splice site probably null
IGL03409:Col17a1 APN 19 47666540 missense possibly damaging 0.79
scabby UTSW 19 47680408 nonsense probably null
IGL03050:Col17a1 UTSW 19 47648098 critical splice donor site probably null
PIT4480001:Col17a1 UTSW 19 47671374 missense probably benign 0.05
R0309:Col17a1 UTSW 19 47671362 splice site probably benign
R0316:Col17a1 UTSW 19 47685533 critical splice donor site probably null
R0330:Col17a1 UTSW 19 47670432 missense probably benign 0.27
R0391:Col17a1 UTSW 19 47663824 missense probably damaging 0.99
R0570:Col17a1 UTSW 19 47665878 missense possibly damaging 0.93
R0737:Col17a1 UTSW 19 47669433 missense possibly damaging 0.95
R1344:Col17a1 UTSW 19 47671505 missense probably damaging 1.00
R1418:Col17a1 UTSW 19 47671505 missense probably damaging 1.00
R1549:Col17a1 UTSW 19 47648910 unclassified probably benign
R1585:Col17a1 UTSW 19 47650837 missense probably benign 0.00
R1710:Col17a1 UTSW 19 47670931 missense probably damaging 1.00
R1712:Col17a1 UTSW 19 47649003 unclassified probably benign
R1800:Col17a1 UTSW 19 47650862 missense possibly damaging 0.72
R2007:Col17a1 UTSW 19 47667702 missense probably damaging 1.00
R2024:Col17a1 UTSW 19 47650746 missense probably benign 0.02
R2258:Col17a1 UTSW 19 47681377 critical splice donor site probably null
R2268:Col17a1 UTSW 19 47650111 missense probably benign 0.00
R3608:Col17a1 UTSW 19 47680405 missense probably benign 0.00
R4380:Col17a1 UTSW 19 47657090 missense possibly damaging 0.94
R4675:Col17a1 UTSW 19 47663058 critical splice acceptor site probably null
R4928:Col17a1 UTSW 19 47670458 splice site probably null
R5058:Col17a1 UTSW 19 47685550 nonsense probably null
R5407:Col17a1 UTSW 19 47666507 missense probably damaging 1.00
R5417:Col17a1 UTSW 19 47662390 missense probably damaging 1.00
R5889:Col17a1 UTSW 19 47649072 missense possibly damaging 0.93
R5988:Col17a1 UTSW 19 47654220 missense probably damaging 1.00
R6054:Col17a1 UTSW 19 47680420 missense probably damaging 1.00
R6345:Col17a1 UTSW 19 47653379 missense possibly damaging 0.93
R6432:Col17a1 UTSW 19 47680408 nonsense probably null
R6484:Col17a1 UTSW 19 47670429 missense possibly damaging 0.67
R6754:Col17a1 UTSW 19 47650721 splice site probably null
R7028:Col17a1 UTSW 19 47652183 missense probably damaging 0.96
Z1088:Col17a1 UTSW 19 47652178 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CGTTCATGCGTACACCCATG -3'
(R):5'- GAACTCCTCCCAGCAGTTAC -3'

Sequencing Primer
(F):5'- ATGCGTACACCCATGTGCTC -3'
(R):5'- AGACACAACTGGGCTTCTAGGTTG -3'
Posted On2016-10-24