Incidental Mutation 'R5573:Vwa5b1'
ID435772
Institutional Source Beutler Lab
Gene Symbol Vwa5b1
Ensembl Gene ENSMUSG00000028753
Gene Namevon Willebrand factor A domain containing 5B1
Synonyms
MMRRC Submission 043128-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock #R5573 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location138565360-138635884 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138608890 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 131 (E131G)
Ref Sequence ENSEMBL: ENSMUSP00000030533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030533] [ENSMUST00000105812]
Predicted Effect probably damaging
Transcript: ENSMUST00000030533
AA Change: E131G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030533
Gene: ENSMUSG00000028753
AA Change: E131G

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 2e-28 PFAM
Pfam:VIT 15 138 1.5e-7 PFAM
VWA 351 513 6.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105812
SMART Domains Protein: ENSMUSP00000101438
Gene: ENSMUSG00000028753

DomainStartEndE-ValueType
Pfam:VIT_2 16 93 1.9e-30 PFAM
Pfam:VIT 29 103 2.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154312
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef28 A T 13: 97,929,491 V1618D probably benign Het
Asic5 T A 3: 82,004,484 F129Y probably benign Het
Cachd1 A C 4: 100,974,079 K689N probably damaging Het
Cbfa2t2 A G 2: 154,436,862 probably benign Het
Cdh26 T C 2: 178,466,689 V360A probably damaging Het
Col9a3 C T 2: 180,619,732 A605V probably benign Het
Csn3 A G 5: 87,930,051 T139A probably benign Het
Ddx27 G T 2: 167,017,886 K79N possibly damaging Het
Dhx29 G A 13: 112,933,215 D211N probably benign Het
Dlg2 A G 7: 91,997,324 probably null Het
Dse C A 10: 34,152,682 R804L probably benign Het
Fgb T C 3: 83,049,677 probably null Het
Gm11011 A T 2: 169,587,472 I31K unknown Het
Hira A G 16: 18,916,599 T272A probably damaging Het
Lcmt1 T A 7: 123,401,463 H117Q probably benign Het
Mettl23 A G 11: 116,843,611 probably benign Het
Mtmr2 T C 9: 13,793,167 Y197H probably benign Het
Myo9a T G 9: 59,871,001 S1347A probably benign Het
Myrfl A G 10: 116,822,756 V432A probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Obscn G T 11: 59,034,705 H6347Q possibly damaging Het
Olfr582 A T 7: 103,042,340 Y282F probably damaging Het
Olfr920 T A 9: 38,755,704 N5K probably damaging Het
Peg10 A G 6: 4,755,913 probably benign Het
Pfkfb3 A G 2: 11,501,672 V10A probably benign Het
Phf12 A G 11: 78,025,045 D175G probably damaging Het
Plekhg6 T G 6: 125,375,792 I131L possibly damaging Het
Ptbp3 A G 4: 59,485,626 V95A probably damaging Het
Rbbp8 A G 18: 11,722,607 T604A probably benign Het
Rbbp8nl G A 2: 180,279,793 P266L possibly damaging Het
Ryr1 T C 7: 29,015,723 S4659G unknown Het
Serpinb9d A G 13: 33,196,440 probably null Het
Slc22a28 A C 19: 8,071,097 I395S possibly damaging Het
Slco6c1 T A 1: 97,127,931 I82L probably benign Het
Sptan1 C T 2: 29,986,492 R295* probably null Het
Tdrd9 C T 12: 111,997,902 probably null Het
Ube2v2 A G 16: 15,556,479 L77P possibly damaging Het
Ugt3a2 T C 15: 9,361,683 S182P probably damaging Het
Wdr18 C T 10: 79,965,038 A145V probably benign Het
Xpnpep1 A G 19: 53,004,822 I358T probably damaging Het
Zfp946 T A 17: 22,454,695 C143* probably null Het
Other mutations in Vwa5b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01952:Vwa5b1 APN 4 138581217 missense probably benign 0.08
IGL02133:Vwa5b1 APN 4 138586557 critical splice donor site probably null
IGL02379:Vwa5b1 APN 4 138612859 missense probably damaging 1.00
IGL02671:Vwa5b1 APN 4 138569126 nonsense probably null
IGL02864:Vwa5b1 APN 4 138608975 missense probably benign 0.00
IGL03076:Vwa5b1 APN 4 138600188 missense probably damaging 1.00
IGL03115:Vwa5b1 APN 4 138600149 missense possibly damaging 0.93
IGL03119:Vwa5b1 APN 4 138606541 missense probably benign 0.01
R0114:Vwa5b1 UTSW 4 138608858 nonsense probably null
R0157:Vwa5b1 UTSW 4 138604879 missense probably benign 0.00
R0528:Vwa5b1 UTSW 4 138594351 missense probably damaging 1.00
R0562:Vwa5b1 UTSW 4 138635711 splice site probably benign
R0718:Vwa5b1 UTSW 4 138608824 missense probably damaging 1.00
R1555:Vwa5b1 UTSW 4 138605477 missense probably benign 0.02
R1573:Vwa5b1 UTSW 4 138604873 missense probably damaging 1.00
R1857:Vwa5b1 UTSW 4 138569102 missense probably damaging 1.00
R1883:Vwa5b1 UTSW 4 138575389 missense probably damaging 0.96
R1906:Vwa5b1 UTSW 4 138600236 missense possibly damaging 0.93
R1913:Vwa5b1 UTSW 4 138592020 nonsense probably null
R2121:Vwa5b1 UTSW 4 138588569 missense probably benign 0.00
R2213:Vwa5b1 UTSW 4 138604812 missense probably benign 0.00
R2355:Vwa5b1 UTSW 4 138591910 critical splice donor site probably null
R2655:Vwa5b1 UTSW 4 138594303 missense probably damaging 1.00
R4134:Vwa5b1 UTSW 4 138594330 missense possibly damaging 0.69
R4135:Vwa5b1 UTSW 4 138594330 missense possibly damaging 0.69
R4635:Vwa5b1 UTSW 4 138610839 missense possibly damaging 0.82
R4773:Vwa5b1 UTSW 4 138581755 missense probably benign 0.01
R4832:Vwa5b1 UTSW 4 138605540 missense probably damaging 1.00
R4906:Vwa5b1 UTSW 4 138610747 missense probably benign 0.03
R4916:Vwa5b1 UTSW 4 138594262 missense possibly damaging 0.81
R4995:Vwa5b1 UTSW 4 138608843 missense probably damaging 1.00
R5872:Vwa5b1 UTSW 4 138578651 missense possibly damaging 0.63
R6255:Vwa5b1 UTSW 4 138578672 missense probably benign 0.00
R6811:Vwa5b1 UTSW 4 138592103 missense probably benign 0.00
R6901:Vwa5b1 UTSW 4 138586569 missense probably benign
R7144:Vwa5b1 UTSW 4 138605431 critical splice donor site unknown
R7146:Vwa5b1 UTSW 4 138581612 missense not run
Predicted Primers PCR Primer
(F):5'- ACCAAGATGGGGCTTTTCAGG -3'
(R):5'- GCCCACATCAAGTTTAGAGGG -3'

Sequencing Primer
(F):5'- TGACCAGGTCCCAGTCTG -3'
(R):5'- CCACATCAAGTTTAGAGGGGGTCAG -3'
Posted On2016-10-24