Incidental Mutation 'R5539:Aldh4a1'
ID435815
Institutional Source Beutler Lab
Gene Symbol Aldh4a1
Ensembl Gene ENSMUSG00000028737
Gene Namealdehyde dehydrogenase 4 family, member A1
SynonymsP5CDH, Ssdh1, A930035F14Rik, ALDH4, Ahd1, Ahd-1
MMRRC Submission 043097-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R5539 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location139622866-139649690 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139638522 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 275 (S275P)
Ref Sequence ENSEMBL: ENSMUSP00000043821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039818] [ENSMUST00000178644]
PDB Structure
Crystal structure of mouse 1-pyrroline-5-carboxylate dehydrogenase complexed with sulfate ion [X-RAY DIFFRACTION]
Crystal structure of mouse 1-pyrroline-5-carboxylate dehydrogenase complexed with the product glutamate [X-RAY DIFFRACTION]
Crystal structure of mouse 1-pyrroline-5-carboxylate dehydrogenase complexed with NAD+ [X-RAY DIFFRACTION]
Crystal Structure of Mus musculus 1-pyrroline-5-carboxylate dehydrogenase cryoprotected in proline [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with acetate [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with glyoxylate [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with malonate [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with succinate [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with glutarate [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000039818
AA Change: S275P

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000043821
Gene: ENSMUSG00000028737
AA Change: S275P

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Aldedh 73 546 7.6e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146309
Predicted Effect probably benign
Transcript: ENSMUST00000178644
SMART Domains Protein: ENSMUSP00000136776
Gene: ENSMUSG00000094439

DomainStartEndE-ValueType
SCOP:d1lbva_ 1 60 5e-3 SMART
Pfam:Filament 165 253 7.3e-13 PFAM
low complexity region 255 268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. This enzyme is a mitochondrial matrix NAD-dependent dehydrogenase which catalyzes the second step of the proline degradation pathway, converting pyrroline-5-carboxylate to glutamate. Deficiency of this enzyme is associated with type II hyperprolinemia, an autosomal recessive disorder characterized by accumulation of delta-1-pyrroline-5-carboxylate (P5C) and proline. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A T 16: 88,759,029 S44C probably damaging Het
Abca4 A G 3: 122,169,908 I846V probably damaging Het
Arhgap12 A T 18: 6,111,932 L144H probably benign Het
Ccdc141 A T 2: 77,015,093 I1210N probably damaging Het
Ccdc175 T C 12: 72,144,813 T330A probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dnah17 T C 11: 118,073,660 K2444E probably benign Het
Dnajc3 G A 14: 118,970,747 V265M probably damaging Het
Flg2 T A 3: 93,220,446 Y2222N unknown Het
Flnc G T 6: 29,446,230 G882V probably damaging Het
Fndc5 T A 4: 129,138,721 V39D probably damaging Het
Gabrr3 A T 16: 59,461,395 H371L probably benign Het
Gm10717 A T 9: 3,030,438 H33L probably damaging Het
Gm5422 A G 10: 31,248,650 noncoding transcript Het
Kri1 G A 9: 21,279,372 Q280* probably null Het
Lcp1 T C 14: 75,229,298 V615A probably benign Het
Ltbp4 T C 7: 27,327,724 Y407C probably damaging Het
Med30 G T 15: 52,721,066 D127Y probably damaging Het
Mybpc2 A G 7: 44,514,893 V416A probably benign Het
Notch2 C T 3: 98,137,582 R1607C probably damaging Het
Nr4a3 T A 4: 48,056,525 probably null Het
Ntf5 G T 7: 45,415,930 R162L probably benign Het
Nxpe3 A G 16: 55,890,671 W2R possibly damaging Het
Olfr115 T A 17: 37,610,755 M1L probably benign Het
Olfr24 G A 9: 18,754,838 R266C probably damaging Het
Olfr482 A T 7: 108,095,226 C115S probably benign Het
Olfr934 T C 9: 38,982,277 I256V possibly damaging Het
Pan2 C A 10: 128,308,133 D99E probably benign Het
Pcdh12 T C 18: 38,281,744 H776R possibly damaging Het
Prdm2 T C 4: 143,132,694 H1342R possibly damaging Het
Prpf8 A G 11: 75,503,638 T1800A probably benign Het
Prss40 T C 1: 34,552,679 *148W probably null Het
Pygo1 C T 9: 72,944,779 P83S probably damaging Het
Raf1 G T 6: 115,619,356 S619R probably damaging Het
Rtf1 A G 2: 119,729,924 M596V possibly damaging Het
Slc12a5 T A 2: 164,987,206 D578E possibly damaging Het
Slc35b4 A G 6: 34,176,802 V18A probably damaging Het
Spata31 T A 13: 64,922,969 I977K probably benign Het
Tor2a T C 2: 32,760,660 I222T probably damaging Het
Trim23 T C 13: 104,198,033 V347A probably damaging Het
Trip11 A G 12: 101,885,127 S893P probably damaging Het
Trmt10c G A 16: 56,034,961 P104S probably damaging Het
Ubr3 A T 2: 70,020,533 Y1765F probably damaging Het
Zfp951 C T 5: 104,814,846 E285K probably damaging Het
Other mutations in Aldh4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Aldh4a1 APN 4 139642160 nonsense probably null
IGL01916:Aldh4a1 APN 4 139644146 missense probably damaging 1.00
IGL02368:Aldh4a1 APN 4 139648200 nonsense probably null
IGL02469:Aldh4a1 APN 4 139648161 missense probably damaging 0.98
PIT4402001:Aldh4a1 UTSW 4 139642191 nonsense probably null
R0511:Aldh4a1 UTSW 4 139642571 splice site probably benign
R1352:Aldh4a1 UTSW 4 139635519 missense probably benign 0.18
R1484:Aldh4a1 UTSW 4 139643447 missense probably benign 0.00
R1717:Aldh4a1 UTSW 4 139638529 missense possibly damaging 0.93
R1717:Aldh4a1 UTSW 4 139633994 splice site probably null
R1729:Aldh4a1 UTSW 4 139644161 missense probably damaging 1.00
R1784:Aldh4a1 UTSW 4 139644161 missense probably damaging 1.00
R1785:Aldh4a1 UTSW 4 139644128 missense probably benign 0.01
R1786:Aldh4a1 UTSW 4 139644128 missense probably benign 0.01
R3696:Aldh4a1 UTSW 4 139642251 missense possibly damaging 0.68
R3697:Aldh4a1 UTSW 4 139642251 missense possibly damaging 0.68
R3698:Aldh4a1 UTSW 4 139642251 missense possibly damaging 0.68
R4603:Aldh4a1 UTSW 4 139643429 missense probably damaging 0.97
R5197:Aldh4a1 UTSW 4 139648301 intron probably benign
R5375:Aldh4a1 UTSW 4 139633922 missense probably benign
R5590:Aldh4a1 UTSW 4 139642104 missense probably damaging 1.00
R6101:Aldh4a1 UTSW 4 139638495 missense possibly damaging 0.91
R6105:Aldh4a1 UTSW 4 139638495 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CATGGTTGGTCTTTCGCCAC -3'
(R):5'- TTCACCAAGATAGGGACCCC -3'

Sequencing Primer
(F):5'- ACCTTGTGAATCATGTTTGACACC -3'
(R):5'- ACTCTCATTCGGCACAGTGG -3'
Posted On2016-10-24