Incidental Mutation 'R5540:Asph'
ID435866
Institutional Source Beutler Lab
Gene Symbol Asph
Ensembl Gene ENSMUSG00000028207
Gene Nameaspartate-beta-hydroxylase
Synonymsaspartyl beta-hydroxylase, BAH, calsequestrin-binding protein, jumbug, 2310005F16Rik, 3110001L23Rik, junctate, cI-37, Junctin
MMRRC Submission 043098-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5540 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location9448069-9669344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9635906 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 77 (L77S)
Ref Sequence ENSEMBL: ENSMUSP00000116874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038564] [ENSMUST00000078139] [ENSMUST00000084912] [ENSMUST00000084915] [ENSMUST00000098275] [ENSMUST00000103004] [ENSMUST00000108333] [ENSMUST00000108334] [ENSMUST00000108335] [ENSMUST00000108337] [ENSMUST00000108339] [ENSMUST00000108340] [ENSMUST00000131605] [ENSMUST00000146441] [ENSMUST00000152526]
Predicted Effect probably damaging
Transcript: ENSMUST00000038564
AA Change: L115S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049018
Gene: ENSMUSG00000028207
AA Change: L115S

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 244 1.6e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078139
AA Change: L115S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077273
Gene: ENSMUSG00000028207
AA Change: L115S

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 307 7e-104 PFAM
Pfam:TPR_6 326 357 4.4e-5 PFAM
Pfam:TPR_16 328 398 1.3e-9 PFAM
Pfam:TPR_2 439 470 2.6e-4 PFAM
Pfam:TPR_8 441 470 1.7e-3 PFAM
Pfam:Asp_Arg_Hydrox 574 728 7.6e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084912
AA Change: L130S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081975
Gene: ENSMUSG00000028207
AA Change: L130S

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 163 1.5e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084915
AA Change: L115S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081978
Gene: ENSMUSG00000028207
AA Change: L115S

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 307 6.2e-105 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098275
AA Change: L115S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095876
Gene: ENSMUSG00000028207
AA Change: L115S

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 188 5.6e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103004
AA Change: L77S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100069
Gene: ENSMUSG00000028207
AA Change: L77S

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 14 81 5.2e-49 PFAM
Pfam:Asp-B-Hydro_N 78 206 1.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108333
AA Change: L77S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103970
Gene: ENSMUSG00000028207
AA Change: L77S

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 14 128 5.8e-59 PFAM
Pfam:Asp-B-Hydro_N 121 258 8.8e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108334
AA Change: L77S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103971
Gene: ENSMUSG00000028207
AA Change: L77S

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 14 269 3.8e-105 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108335
AA Change: L77S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103972
Gene: ENSMUSG00000028207
AA Change: L77S

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 14 84 1.6e-49 PFAM
Pfam:Asp-B-Hydro_N 79 212 1.6e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108337
AA Change: L115S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103974
Gene: ENSMUSG00000028207
AA Change: L115S

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 291 1.8e-96 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108339
AA Change: L48S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103976
Gene: ENSMUSG00000028207
AA Change: L48S

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 1 224 1.6e-80 PFAM
Pfam:TPR_6 243 274 1.4e-4 PFAM
Pfam:TPR_16 245 315 2.5e-9 PFAM
Pfam:TPR_2 356 387 7e-4 PFAM
Pfam:Asp_Arg_Hydrox 489 646 5.3e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108340
AA Change: L115S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103977
Gene: ENSMUSG00000028207
AA Change: L115S

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 291 8.6e-96 PFAM
Pfam:TPR_6 310 341 1.9e-4 PFAM
Pfam:TPR_16 312 382 2.9e-9 PFAM
Pfam:TPR_2 423 454 6.8e-4 PFAM
Pfam:Asp_Arg_Hydrox 556 713 3.8e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131605
AA Change: L63S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118518
Gene: ENSMUSG00000028207
AA Change: L63S

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 1 73 2.7e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137375
Predicted Effect probably damaging
Transcript: ENSMUST00000146441
AA Change: L130S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116899
Gene: ENSMUSG00000028207
AA Change: L130S

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 203 1.2e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152058
Predicted Effect probably damaging
Transcript: ENSMUST00000152526
AA Change: L77S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116874
Gene: ENSMUSG00000028207
AA Change: L77S

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 14 149 8.2e-70 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play an important role in calcium homeostasis. The gene is expressed from two promoters and undergoes extensive alternative splicing. The encoded set of proteins share varying amounts of overlap near their N-termini but have substantial variations in their C-terminal domains resulting in distinct functional properties. The longest isoforms (a and f) include a C-terminal Aspartyl/Asparaginyl beta-hydroxylase domain that hydroxylates aspartic acid or asparagine residues in the epidermal growth factor (EGF)-like domains of some proteins, including protein C, coagulation factors VII, IX, and X, and the complement factors C1R and C1S. Other isoforms differ primarily in the C-terminal sequence and lack the hydroxylase domain, and some have been localized to the endoplasmic and sarcoplasmic reticulum. Some of these isoforms are found in complexes with calsequestrin, triadin, and the ryanodine receptor, and have been shown to regulate calcium release from the sarcoplasmic reticulum. Some isoforms have been implicated in metastasis. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for a mutation lacking aspartyl beta-hydroxylase expression exhibit syndactyly, facial dysmorphology, mild hard palate defects, and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,362,947 S15P probably damaging Het
Actl7a A T 4: 56,744,388 H305L probably benign Het
Adam26b C A 8: 43,521,617 C116F probably damaging Het
Adgrl2 A G 3: 148,837,562 probably null Het
Akr1b10 A G 6: 34,394,112 T238A probably damaging Het
Akr1c18 A G 13: 4,137,179 V186A probably benign Het
Alpk3 G A 7: 81,095,436 V1311M probably damaging Het
Aox1 A G 1: 58,104,410 N1229S probably benign Het
Apobec3 T A 15: 79,897,919 N43K probably benign Het
Arid1a A C 4: 133,680,454 D2247E unknown Het
Cd300ld T A 11: 114,987,405 T94S probably damaging Het
Celf2 T C 2: 6,553,932 T382A probably benign Het
Cfap54 C T 10: 92,972,608 A1402T possibly damaging Het
Chrnb1 A T 11: 69,795,650 V48E probably benign Het
Col6a5 T A 9: 105,862,776 E2548V probably benign Het
Crebrf A G 17: 26,742,097 D56G possibly damaging Het
Dctn5 A G 7: 122,135,052 T40A probably benign Het
Dmxl2 A T 9: 54,393,857 N2323K probably benign Het
Dync1h1 A G 12: 110,660,950 Q4021R probably benign Het
Dyrk1a T G 16: 94,685,343 probably null Het
Ephb3 T A 16: 21,220,860 F454Y probably damaging Het
Fam71b A G 11: 46,404,888 N29S probably damaging Het
Fbxo38 A G 18: 62,514,793 probably null Het
Flg T C 3: 93,277,616 F15S probably damaging Het
Fndc3b G A 3: 27,501,502 P301L probably damaging Het
Fpr-rs7 C T 17: 20,114,094 G45R probably damaging Het
Gfi1 T A 5: 107,720,125 T360S probably damaging Het
Grik4 T C 9: 42,520,947 H918R probably damaging Het
Hpx A G 7: 105,591,912 S385P possibly damaging Het
Kdm5b A G 1: 134,631,241 D1501G probably damaging Het
Kif20b A T 19: 34,938,460 M546L probably benign Het
Map3k9 G T 12: 81,772,813 N222K probably damaging Het
Me1 A G 9: 86,679,873 L53P possibly damaging Het
Mis18bp1 T C 12: 65,148,746 E748G possibly damaging Het
Morc3 T A 16: 93,847,380 N186K probably benign Het
Mtor A G 4: 148,454,708 T221A probably benign Het
Muc6 A G 7: 141,649,585 probably null Het
Myh8 C A 11: 67,286,440 T444N probably benign Het
Myo7b A G 18: 32,007,090 Y216H probably damaging Het
Myom1 G A 17: 71,109,787 V1382M probably damaging Het
Nbeal2 A T 9: 110,631,733 Y1718N probably damaging Het
Npc1l1 A G 11: 6,214,546 S1168P probably damaging Het
Olfr1431 T A 19: 12,210,460 I298N probably damaging Het
Olfr463 T A 11: 87,893,685 K80* probably null Het
Olfr48 A G 2: 89,844,667 F102S probably damaging Het
Olfr561 C T 7: 102,774,929 A135V probably benign Het
Olfr765 G T 10: 129,046,495 D189E probably damaging Het
Pcdha4 C A 18: 36,954,837 A691E probably benign Het
Pde6a T G 18: 61,231,366 F165V probably damaging Het
Pqlc2 A T 4: 139,300,344 L229Q probably damaging Het
Ptpn14 A T 1: 189,846,364 M340L probably benign Het
Rnasel G T 1: 153,755,144 E469* probably null Het
Rsph3a T G 17: 7,945,958 L50R probably benign Het
Rusc2 A G 4: 43,423,975 Y1043C probably damaging Het
Serpinb6b A T 13: 32,977,558 K86* probably null Het
Serpine1 T C 5: 137,063,209 T392A probably benign Het
Shcbp1 A T 8: 4,744,529 D421E probably damaging Het
Slc24a1 A G 9: 64,948,581 V348A unknown Het
Slc26a7 A G 4: 14,506,621 F605L probably benign Het
Spag17 A C 3: 100,056,272 E1102A possibly damaging Het
Stab2 A G 10: 86,848,125 V2390A probably benign Het
Stk11 A G 10: 80,126,049 I35V probably benign Het
Stk24 T C 14: 121,294,281 D321G possibly damaging Het
Tbx4 A T 11: 85,911,168 N209I possibly damaging Het
Tmem225 T C 9: 40,149,385 L80P probably damaging Het
Tnfrsf4 C T 4: 156,013,923 T17I probably benign Het
Traf3ip1 G A 1: 91,501,315 R268Q probably benign Het
Trhde T A 10: 114,800,592 I237F probably benign Het
Ugt2a1 A T 5: 87,486,056 W231R probably damaging Het
Vash1 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 12: 86,680,057 probably benign Het
Vps16 T A 2: 130,442,385 D685E probably benign Het
Washc4 A G 10: 83,573,793 D602G probably damaging Het
Wdr59 A G 8: 111,485,184 L377P possibly damaging Het
Wdr81 T C 11: 75,449,070 E1364G probably damaging Het
Other mutations in Asph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Asph APN 4 9639322 missense probably damaging 1.00
IGL00928:Asph APN 4 9594675 missense probably benign 0.07
IGL01022:Asph APN 4 9601344 missense possibly damaging 0.63
IGL01677:Asph APN 4 9607853 missense probably damaging 1.00
IGL01907:Asph APN 4 9514643 missense possibly damaging 0.59
IGL01958:Asph APN 4 9474904 missense possibly damaging 0.93
IGL01976:Asph APN 4 9475471 missense probably damaging 0.98
IGL01989:Asph APN 4 9602462 splice site probably benign
IGL02379:Asph APN 4 9474980 missense probably damaging 1.00
IGL02444:Asph APN 4 9542319 splice site probably benign
IGL02652:Asph APN 4 9529984 missense probably benign 0.11
IGL02679:Asph APN 4 9601349 missense possibly damaging 0.63
IGL02735:Asph APN 4 9598759 missense probably damaging 1.00
IGL02875:Asph APN 4 9595380 missense probably damaging 1.00
IGL03022:Asph APN 4 9517668 missense possibly damaging 0.48
R0026:Asph UTSW 4 9601361 missense probably damaging 0.97
R0121:Asph UTSW 4 9635918 missense probably damaging 1.00
R0357:Asph UTSW 4 9453314 missense probably benign 0.01
R0410:Asph UTSW 4 9595415 missense probably damaging 1.00
R0554:Asph UTSW 4 9604581 missense probably damaging 0.99
R0577:Asph UTSW 4 9604620 missense probably benign 0.02
R0718:Asph UTSW 4 9514683 splice site probably benign
R0725:Asph UTSW 4 9542275 missense probably damaging 1.00
R1383:Asph UTSW 4 9537807 intron probably null
R1654:Asph UTSW 4 9453315 missense probably benign 0.31
R1694:Asph UTSW 4 9610869 missense probably damaging 0.99
R1771:Asph UTSW 4 9598773 missense probably damaging 0.99
R1776:Asph UTSW 4 9598773 missense probably damaging 0.99
R1840:Asph UTSW 4 9601340 missense possibly damaging 0.60
R1911:Asph UTSW 4 9453335 missense probably damaging 1.00
R1912:Asph UTSW 4 9453335 missense probably damaging 1.00
R2117:Asph UTSW 4 9517671 nonsense probably null
R2860:Asph UTSW 4 9598277 missense probably damaging 1.00
R2861:Asph UTSW 4 9598277 missense probably damaging 1.00
R2937:Asph UTSW 4 9542314 splice site probably benign
R3907:Asph UTSW 4 9474934 missense probably benign 0.23
R4154:Asph UTSW 4 9639250 nonsense probably null
R4623:Asph UTSW 4 9622005 missense possibly damaging 0.50
R4871:Asph UTSW 4 9531968 missense probably benign 0.02
R5196:Asph UTSW 4 9607830 missense probably damaging 0.99
R5757:Asph UTSW 4 9637722 intron probably null
R6063:Asph UTSW 4 9531960 missense probably benign 0.05
R6072:Asph UTSW 4 9643533 critical splice donor site probably null
R7016:Asph UTSW 4 9630604 intron probably null
R7133:Asph UTSW 4 9484575 missense probably benign 0.01
R7154:Asph UTSW 4 9630930 missense possibly damaging 0.85
R7201:Asph UTSW 4 9474917 missense probably damaging 1.00
R7316:Asph UTSW 4 9537746 missense probably benign 0.11
Z1088:Asph UTSW 4 9630715 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCTCTCAGAAGTGAAGTGGTG -3'
(R):5'- GCTTTGCAGCAGTAAGTGG -3'

Sequencing Primer
(F):5'- GGAGGAGGGACCCTGTG -3'
(R):5'- CTTTGCAGCAGTAAGTGGAGAGG -3'
Posted On2016-10-24