Incidental Mutation 'R5540:Arid1a'
ID435870
Institutional Source Beutler Lab
Gene Symbol Arid1a
Ensembl Gene ENSMUSG00000007880
Gene NameAT rich interactive domain 1A (SWI-like)
Synonyms1110030E03Rik, Smarcf1, BAF250a, Osa1
MMRRC Submission 043098-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5540 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location133679008-133756769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 133680454 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 2247 (D2247E)
Ref Sequence ENSEMBL: ENSMUSP00000122354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008024] [ENSMUST00000105897] [ENSMUST00000145664]
Predicted Effect unknown
Transcript: ENSMUST00000008024
AA Change: D1862E
SMART Domains Protein: ENSMUSP00000008024
Gene: ENSMUSG00000007880
AA Change: D1862E

DomainStartEndE-ValueType
low complexity region 17 42 N/A INTRINSIC
low complexity region 86 110 N/A INTRINSIC
low complexity region 113 211 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 274 290 N/A INTRINSIC
low complexity region 310 323 N/A INTRINSIC
internal_repeat_3 329 402 4.13e-5 PROSPERO
low complexity region 410 426 N/A INTRINSIC
low complexity region 429 442 N/A INTRINSIC
internal_repeat_1 443 563 4.59e-6 PROSPERO
internal_repeat_2 461 595 1.38e-5 PROSPERO
low complexity region 604 626 N/A INTRINSIC
ARID 630 720 3.56e-25 SMART
BRIGHT 634 725 3.76e-31 SMART
low complexity region 739 751 N/A INTRINSIC
low complexity region 756 770 N/A INTRINSIC
internal_repeat_3 778 872 4.13e-5 PROSPERO
internal_repeat_2 781 928 1.38e-5 PROSPERO
internal_repeat_1 825 940 4.59e-6 PROSPERO
low complexity region 962 987 N/A INTRINSIC
low complexity region 1014 1045 N/A INTRINSIC
low complexity region 1187 1200 N/A INTRINSIC
low complexity region 1380 1404 N/A INTRINSIC
low complexity region 1500 1518 N/A INTRINSIC
Pfam:DUF3518 1592 1848 1.8e-146 PFAM
low complexity region 1849 1859 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000105897
AA Change: D2243E
SMART Domains Protein: ENSMUSP00000101517
Gene: ENSMUSG00000007880
AA Change: D2243E

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 24 52 N/A INTRINSIC
low complexity region 74 96 N/A INTRINSIC
low complexity region 118 148 N/A INTRINSIC
low complexity region 161 169 N/A INTRINSIC
low complexity region 233 266 N/A INTRINSIC
low complexity region 273 295 N/A INTRINSIC
low complexity region 308 332 N/A INTRINSIC
low complexity region 367 373 N/A INTRINSIC
low complexity region 402 427 N/A INTRINSIC
low complexity region 471 495 N/A INTRINSIC
low complexity region 498 596 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
low complexity region 795 811 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
internal_repeat_2 828 948 9.26e-7 PROSPERO
internal_repeat_1 831 980 9.26e-7 PROSPERO
low complexity region 989 1011 N/A INTRINSIC
ARID 1015 1105 3.56e-25 SMART
BRIGHT 1019 1110 3.76e-31 SMART
low complexity region 1124 1136 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
internal_repeat_1 1159 1314 9.26e-7 PROSPERO
internal_repeat_2 1211 1326 9.26e-7 PROSPERO
low complexity region 1343 1368 N/A INTRINSIC
low complexity region 1395 1426 N/A INTRINSIC
low complexity region 1568 1581 N/A INTRINSIC
low complexity region 1761 1785 N/A INTRINSIC
low complexity region 1881 1899 N/A INTRINSIC
Pfam:DUF3518 1973 2229 1.4e-146 PFAM
low complexity region 2230 2240 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000145664
AA Change: D2247E
SMART Domains Protein: ENSMUSP00000122354
Gene: ENSMUSG00000007880
AA Change: D2247E

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 24 52 N/A INTRINSIC
low complexity region 74 96 N/A INTRINSIC
low complexity region 118 148 N/A INTRINSIC
low complexity region 161 169 N/A INTRINSIC
low complexity region 233 266 N/A INTRINSIC
low complexity region 273 295 N/A INTRINSIC
low complexity region 308 332 N/A INTRINSIC
low complexity region 367 373 N/A INTRINSIC
low complexity region 402 427 N/A INTRINSIC
low complexity region 471 495 N/A INTRINSIC
low complexity region 498 596 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
internal_repeat_3 714 787 9.49e-6 PROSPERO
low complexity region 795 811 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
internal_repeat_1 828 948 8.73e-7 PROSPERO
internal_repeat_2 846 980 2.88e-6 PROSPERO
low complexity region 989 1011 N/A INTRINSIC
ARID 1015 1105 3.56e-25 SMART
BRIGHT 1019 1110 3.76e-31 SMART
low complexity region 1124 1136 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
internal_repeat_3 1163 1257 9.49e-6 PROSPERO
internal_repeat_2 1166 1313 2.88e-6 PROSPERO
internal_repeat_1 1210 1325 8.73e-7 PROSPERO
low complexity region 1347 1372 N/A INTRINSIC
low complexity region 1399 1430 N/A INTRINSIC
low complexity region 1572 1585 N/A INTRINSIC
low complexity region 1765 1789 N/A INTRINSIC
low complexity region 1885 1903 N/A INTRINSIC
Pfam:DUF3518 1978 2233 1.3e-117 PFAM
low complexity region 2234 2244 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family, whose members have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. It possesses at least two conserved domains that could be important for its function. First, it has a DNA-binding domain that can specifically bind an AT-rich DNA sequence known to be recognized by a SNF/SWI complex at the beta-globin locus. Second, the C-terminus of the protein can stimulate glucocorticoid receptor-dependent transcriptional activation. It is thought that the protein encoded by this gene confers specificity to the SNF/SWI complex and may recruit the complex to its targets through either protein-DNA or protein-protein interactions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos with homozygous null alleles arrest development at E6.5 with failure to form a mesoderm layer. Mice homozygous for an allele lacking exon 2 and 3 die shortly after birth and exhibit an increase in the hematopoietic stem cell population of the fetal liver at E14.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,362,947 S15P probably damaging Het
Actl7a A T 4: 56,744,388 H305L probably benign Het
Adam26b C A 8: 43,521,617 C116F probably damaging Het
Adgrl2 A G 3: 148,837,562 probably null Het
Akr1b10 A G 6: 34,394,112 T238A probably damaging Het
Akr1c18 A G 13: 4,137,179 V186A probably benign Het
Alpk3 G A 7: 81,095,436 V1311M probably damaging Het
Aox1 A G 1: 58,104,410 N1229S probably benign Het
Apobec3 T A 15: 79,897,919 N43K probably benign Het
Asph A G 4: 9,635,906 L77S probably damaging Het
Cd300ld T A 11: 114,987,405 T94S probably damaging Het
Celf2 T C 2: 6,553,932 T382A probably benign Het
Cfap54 C T 10: 92,972,608 A1402T possibly damaging Het
Chrnb1 A T 11: 69,795,650 V48E probably benign Het
Col6a5 T A 9: 105,862,776 E2548V probably benign Het
Crebrf A G 17: 26,742,097 D56G possibly damaging Het
Dctn5 A G 7: 122,135,052 T40A probably benign Het
Dmxl2 A T 9: 54,393,857 N2323K probably benign Het
Dync1h1 A G 12: 110,660,950 Q4021R probably benign Het
Dyrk1a T G 16: 94,685,343 probably null Het
Ephb3 T A 16: 21,220,860 F454Y probably damaging Het
Fam71b A G 11: 46,404,888 N29S probably damaging Het
Fbxo38 A G 18: 62,514,793 probably null Het
Flg T C 3: 93,277,616 F15S probably damaging Het
Fndc3b G A 3: 27,501,502 P301L probably damaging Het
Fpr-rs7 C T 17: 20,114,094 G45R probably damaging Het
Gfi1 T A 5: 107,720,125 T360S probably damaging Het
Grik4 T C 9: 42,520,947 H918R probably damaging Het
Hpx A G 7: 105,591,912 S385P possibly damaging Het
Kdm5b A G 1: 134,631,241 D1501G probably damaging Het
Kif20b A T 19: 34,938,460 M546L probably benign Het
Map3k9 G T 12: 81,772,813 N222K probably damaging Het
Me1 A G 9: 86,679,873 L53P possibly damaging Het
Mis18bp1 T C 12: 65,148,746 E748G possibly damaging Het
Morc3 T A 16: 93,847,380 N186K probably benign Het
Mtor A G 4: 148,454,708 T221A probably benign Het
Muc6 A G 7: 141,649,585 probably null Het
Myh8 C A 11: 67,286,440 T444N probably benign Het
Myo7b A G 18: 32,007,090 Y216H probably damaging Het
Myom1 G A 17: 71,109,787 V1382M probably damaging Het
Nbeal2 A T 9: 110,631,733 Y1718N probably damaging Het
Npc1l1 A G 11: 6,214,546 S1168P probably damaging Het
Olfr1431 T A 19: 12,210,460 I298N probably damaging Het
Olfr463 T A 11: 87,893,685 K80* probably null Het
Olfr48 A G 2: 89,844,667 F102S probably damaging Het
Olfr561 C T 7: 102,774,929 A135V probably benign Het
Olfr765 G T 10: 129,046,495 D189E probably damaging Het
Pcdha4 C A 18: 36,954,837 A691E probably benign Het
Pde6a T G 18: 61,231,366 F165V probably damaging Het
Pqlc2 A T 4: 139,300,344 L229Q probably damaging Het
Ptpn14 A T 1: 189,846,364 M340L probably benign Het
Rnasel G T 1: 153,755,144 E469* probably null Het
Rsph3a T G 17: 7,945,958 L50R probably benign Het
Rusc2 A G 4: 43,423,975 Y1043C probably damaging Het
Serpinb6b A T 13: 32,977,558 K86* probably null Het
Serpine1 T C 5: 137,063,209 T392A probably benign Het
Shcbp1 A T 8: 4,744,529 D421E probably damaging Het
Slc24a1 A G 9: 64,948,581 V348A unknown Het
Slc26a7 A G 4: 14,506,621 F605L probably benign Het
Spag17 A C 3: 100,056,272 E1102A possibly damaging Het
Stab2 A G 10: 86,848,125 V2390A probably benign Het
Stk11 A G 10: 80,126,049 I35V probably benign Het
Stk24 T C 14: 121,294,281 D321G possibly damaging Het
Tbx4 A T 11: 85,911,168 N209I possibly damaging Het
Tmem225 T C 9: 40,149,385 L80P probably damaging Het
Tnfrsf4 C T 4: 156,013,923 T17I probably benign Het
Traf3ip1 G A 1: 91,501,315 R268Q probably benign Het
Trhde T A 10: 114,800,592 I237F probably benign Het
Ugt2a1 A T 5: 87,486,056 W231R probably damaging Het
Vash1 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 12: 86,680,057 probably benign Het
Vps16 T A 2: 130,442,385 D685E probably benign Het
Washc4 A G 10: 83,573,793 D602G probably damaging Het
Wdr59 A G 8: 111,485,184 L377P possibly damaging Het
Wdr81 T C 11: 75,449,070 E1364G probably damaging Het
Other mutations in Arid1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Arid1a APN 4 133685482 missense unknown
IGL01139:Arid1a APN 4 133693997 missense unknown
IGL01392:Arid1a APN 4 133681037 missense unknown
IGL01543:Arid1a APN 4 133681722 missense unknown
IGL01642:Arid1a APN 4 133681844 missense unknown
IGL01843:Arid1a APN 4 133681454 missense unknown
IGL02108:Arid1a APN 4 133680516 missense unknown
IGL02117:Arid1a APN 4 133692815 missense unknown
IGL02150:Arid1a APN 4 133687257 missense unknown
IGL02478:Arid1a APN 4 133681274 missense unknown
IGL02544:Arid1a APN 4 133681748 missense unknown
IGL03070:Arid1a APN 4 133694753 missense unknown
PIT4520001:Arid1a UTSW 4 133681916 missense unknown
R0023:Arid1a UTSW 4 133691176 missense unknown
R0023:Arid1a UTSW 4 133691176 missense unknown
R0419:Arid1a UTSW 4 133681124 missense unknown
R0452:Arid1a UTSW 4 133689105 missense unknown
R0631:Arid1a UTSW 4 133689170 missense unknown
R0648:Arid1a UTSW 4 133685204 missense unknown
R1004:Arid1a UTSW 4 133687275 missense unknown
R1225:Arid1a UTSW 4 133687365 missense unknown
R1229:Arid1a UTSW 4 133691237 missense unknown
R1435:Arid1a UTSW 4 133680698 missense unknown
R1480:Arid1a UTSW 4 133680389 missense unknown
R1491:Arid1a UTSW 4 133720926 missense unknown
R1674:Arid1a UTSW 4 133689260 missense unknown
R1909:Arid1a UTSW 4 133693761 missense unknown
R1960:Arid1a UTSW 4 133753090 missense possibly damaging 0.84
R2018:Arid1a UTSW 4 133681834 missense unknown
R2147:Arid1a UTSW 4 133681366 missense unknown
R2303:Arid1a UTSW 4 133687251 missense unknown
R2320:Arid1a UTSW 4 133680529 missense unknown
R3775:Arid1a UTSW 4 133686764 missense unknown
R3907:Arid1a UTSW 4 133692912 splice site probably benign
R4509:Arid1a UTSW 4 133695699 intron probably benign
R4510:Arid1a UTSW 4 133695699 intron probably benign
R4551:Arid1a UTSW 4 133695699 intron probably benign
R4552:Arid1a UTSW 4 133695699 intron probably benign
R4606:Arid1a UTSW 4 133687323 missense unknown
R4745:Arid1a UTSW 4 133753106 missense probably benign 0.33
R4851:Arid1a UTSW 4 133681361 missense unknown
R4867:Arid1a UTSW 4 133720857 missense probably benign 0.01
R5203:Arid1a UTSW 4 133682003 missense unknown
R5227:Arid1a UTSW 4 133680405 missense unknown
R5294:Arid1a UTSW 4 133691055 splice site probably benign
R5299:Arid1a UTSW 4 133687226 missense unknown
R5412:Arid1a UTSW 4 133719602 unclassified probably benign
R5704:Arid1a UTSW 4 133681739 missense unknown
R5870:Arid1a UTSW 4 133681076 missense unknown
R6092:Arid1a UTSW 4 133693852 missense unknown
R6151:Arid1a UTSW 4 133684976 missense unknown
R6240:Arid1a UTSW 4 133680686 missense unknown
R6379:Arid1a UTSW 4 133680927 missense unknown
R6427:Arid1a UTSW 4 133681524 missense unknown
R6739:Arid1a UTSW 4 133687626 missense unknown
X0064:Arid1a UTSW 4 133689260 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGGCAACAGTCAGTTTCTAAGTTC -3'
(R):5'- GGTACTGCTGGCAAATCTGG -3'

Sequencing Primer
(F):5'- AACAGTCAGTTTCTAAGTTCTCCAC -3'
(R):5'- CCATTGCAGTGCAGAAGGGC -3'
Posted On2016-10-24