Incidental Mutation 'R5540:Wdr59'
ID435886
Institutional Source Beutler Lab
Gene Symbol Wdr59
Ensembl Gene ENSMUSG00000031959
Gene NameWD repeat domain 59
Synonyms5430401O09Rik
MMRRC Submission 043098-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R5540 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location111448797-111522092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111485184 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 377 (L377P)
Ref Sequence ENSEMBL: ENSMUSP00000043671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034437] [ENSMUST00000038193] [ENSMUST00000211981]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034437
AA Change: L377P

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034437
Gene: ENSMUSG00000031959
AA Change: L377P

DomainStartEndE-ValueType
WD40 41 91 1.37e2 SMART
WD40 94 134 9.52e-6 SMART
WD40 138 176 4.46e-1 SMART
WD40 180 220 2.59e-7 SMART
WD40 271 315 8.59e-1 SMART
RWD 393 494 4.13e-14 SMART
low complexity region 620 632 N/A INTRINSIC
low complexity region 802 813 N/A INTRINSIC
Blast:RING 941 980 3e-10 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000038193
AA Change: L377P

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000043671
Gene: ENSMUSG00000031959
AA Change: L377P

DomainStartEndE-ValueType
WD40 41 91 1.37e2 SMART
WD40 94 134 9.52e-6 SMART
WD40 138 176 4.46e-1 SMART
WD40 180 220 2.59e-7 SMART
WD40 271 315 8.59e-1 SMART
RWD 393 494 4.13e-14 SMART
low complexity region 803 814 N/A INTRINSIC
Pfam:Zn_ribbon_17 937 992 2e-14 PFAM
Pfam:zinc_ribbon_16 949 990 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211981
AA Change: L377P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212327
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,362,947 S15P probably damaging Het
Actl7a A T 4: 56,744,388 H305L probably benign Het
Adam26b C A 8: 43,521,617 C116F probably damaging Het
Adgrl2 A G 3: 148,837,562 probably null Het
Akr1b10 A G 6: 34,394,112 T238A probably damaging Het
Akr1c18 A G 13: 4,137,179 V186A probably benign Het
Alpk3 G A 7: 81,095,436 V1311M probably damaging Het
Aox1 A G 1: 58,104,410 N1229S probably benign Het
Apobec3 T A 15: 79,897,919 N43K probably benign Het
Arid1a A C 4: 133,680,454 D2247E unknown Het
Asph A G 4: 9,635,906 L77S probably damaging Het
Cd300ld T A 11: 114,987,405 T94S probably damaging Het
Celf2 T C 2: 6,553,932 T382A probably benign Het
Cfap54 C T 10: 92,972,608 A1402T possibly damaging Het
Chrnb1 A T 11: 69,795,650 V48E probably benign Het
Col6a5 T A 9: 105,862,776 E2548V probably benign Het
Crebrf A G 17: 26,742,097 D56G possibly damaging Het
Dctn5 A G 7: 122,135,052 T40A probably benign Het
Dmxl2 A T 9: 54,393,857 N2323K probably benign Het
Dync1h1 A G 12: 110,660,950 Q4021R probably benign Het
Dyrk1a T G 16: 94,685,343 probably null Het
Ephb3 T A 16: 21,220,860 F454Y probably damaging Het
Fam71b A G 11: 46,404,888 N29S probably damaging Het
Fbxo38 A G 18: 62,514,793 probably null Het
Flg T C 3: 93,277,616 F15S probably damaging Het
Fndc3b G A 3: 27,501,502 P301L probably damaging Het
Fpr-rs7 C T 17: 20,114,094 G45R probably damaging Het
Gfi1 T A 5: 107,720,125 T360S probably damaging Het
Grik4 T C 9: 42,520,947 H918R probably damaging Het
Hpx A G 7: 105,591,912 S385P possibly damaging Het
Kdm5b A G 1: 134,631,241 D1501G probably damaging Het
Kif20b A T 19: 34,938,460 M546L probably benign Het
Map3k9 G T 12: 81,772,813 N222K probably damaging Het
Me1 A G 9: 86,679,873 L53P possibly damaging Het
Mis18bp1 T C 12: 65,148,746 E748G possibly damaging Het
Morc3 T A 16: 93,847,380 N186K probably benign Het
Mtor A G 4: 148,454,708 T221A probably benign Het
Muc6 A G 7: 141,649,585 probably null Het
Myh8 C A 11: 67,286,440 T444N probably benign Het
Myo7b A G 18: 32,007,090 Y216H probably damaging Het
Myom1 G A 17: 71,109,787 V1382M probably damaging Het
Nbeal2 A T 9: 110,631,733 Y1718N probably damaging Het
Npc1l1 A G 11: 6,214,546 S1168P probably damaging Het
Olfr1431 T A 19: 12,210,460 I298N probably damaging Het
Olfr463 T A 11: 87,893,685 K80* probably null Het
Olfr48 A G 2: 89,844,667 F102S probably damaging Het
Olfr561 C T 7: 102,774,929 A135V probably benign Het
Olfr765 G T 10: 129,046,495 D189E probably damaging Het
Pcdha4 C A 18: 36,954,837 A691E probably benign Het
Pde6a T G 18: 61,231,366 F165V probably damaging Het
Pqlc2 A T 4: 139,300,344 L229Q probably damaging Het
Ptpn14 A T 1: 189,846,364 M340L probably benign Het
Rnasel G T 1: 153,755,144 E469* probably null Het
Rsph3a T G 17: 7,945,958 L50R probably benign Het
Rusc2 A G 4: 43,423,975 Y1043C probably damaging Het
Serpinb6b A T 13: 32,977,558 K86* probably null Het
Serpine1 T C 5: 137,063,209 T392A probably benign Het
Shcbp1 A T 8: 4,744,529 D421E probably damaging Het
Slc24a1 A G 9: 64,948,581 V348A unknown Het
Slc26a7 A G 4: 14,506,621 F605L probably benign Het
Spag17 A C 3: 100,056,272 E1102A possibly damaging Het
Stab2 A G 10: 86,848,125 V2390A probably benign Het
Stk11 A G 10: 80,126,049 I35V probably benign Het
Stk24 T C 14: 121,294,281 D321G possibly damaging Het
Tbx4 A T 11: 85,911,168 N209I possibly damaging Het
Tmem225 T C 9: 40,149,385 L80P probably damaging Het
Tnfrsf4 C T 4: 156,013,923 T17I probably benign Het
Traf3ip1 G A 1: 91,501,315 R268Q probably benign Het
Trhde T A 10: 114,800,592 I237F probably benign Het
Ugt2a1 A T 5: 87,486,056 W231R probably damaging Het
Vash1 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 12: 86,680,057 probably benign Het
Vps16 T A 2: 130,442,385 D685E probably benign Het
Washc4 A G 10: 83,573,793 D602G probably damaging Het
Wdr81 T C 11: 75,449,070 E1364G probably damaging Het
Other mutations in Wdr59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Wdr59 APN 8 111458736 missense probably damaging 0.98
IGL01330:Wdr59 APN 8 111481933 missense possibly damaging 0.87
IGL01413:Wdr59 APN 8 111501074 missense probably benign 0.23
IGL02306:Wdr59 APN 8 111492733 missense probably damaging 1.00
IGL03027:Wdr59 APN 8 111462192 missense probably damaging 1.00
IGL03057:Wdr59 APN 8 111476118 missense probably damaging 1.00
IGL03204:Wdr59 APN 8 111485370 missense probably benign 0.05
R0056:Wdr59 UTSW 8 111480607 splice site probably benign
R0096:Wdr59 UTSW 8 111504373 missense probably damaging 1.00
R0096:Wdr59 UTSW 8 111504373 missense probably damaging 1.00
R0440:Wdr59 UTSW 8 111480540 small deletion probably benign
R0452:Wdr59 UTSW 8 111521972 missense possibly damaging 0.87
R0472:Wdr59 UTSW 8 111486997 critical splice acceptor site probably null
R0501:Wdr59 UTSW 8 111458947 missense possibly damaging 0.90
R0526:Wdr59 UTSW 8 111480540 small deletion probably benign
R0534:Wdr59 UTSW 8 111480540 small deletion probably benign
R0601:Wdr59 UTSW 8 111480540 small deletion probably benign
R1144:Wdr59 UTSW 8 111486944 missense probably benign 0.09
R1415:Wdr59 UTSW 8 111498596 missense probably damaging 1.00
R1571:Wdr59 UTSW 8 111451050 missense probably damaging 0.98
R1661:Wdr59 UTSW 8 111479362 missense probably damaging 1.00
R1665:Wdr59 UTSW 8 111479362 missense probably damaging 1.00
R1839:Wdr59 UTSW 8 111485340 missense probably benign
R1856:Wdr59 UTSW 8 111476181 missense probably damaging 1.00
R1872:Wdr59 UTSW 8 111459017 missense probably damaging 1.00
R1921:Wdr59 UTSW 8 111486950 nonsense probably null
R1965:Wdr59 UTSW 8 111451077 missense probably damaging 1.00
R1966:Wdr59 UTSW 8 111450903 missense possibly damaging 0.92
R1977:Wdr59 UTSW 8 111458638 missense probably benign 0.00
R2019:Wdr59 UTSW 8 111466793 missense probably damaging 1.00
R4245:Wdr59 UTSW 8 111490364 missense possibly damaging 0.63
R4471:Wdr59 UTSW 8 111466787 critical splice donor site probably null
R4820:Wdr59 UTSW 8 111480814 missense probably benign 0.19
R5198:Wdr59 UTSW 8 111481988 missense probably benign 0.00
R5571:Wdr59 UTSW 8 111465831 missense probably damaging 1.00
R6166:Wdr59 UTSW 8 111472661 missense probably damaging 1.00
R6732:Wdr59 UTSW 8 111501052 missense probably damaging 1.00
R6767:Wdr59 UTSW 8 111476101 missense probably damaging 1.00
R6823:Wdr59 UTSW 8 111459040 missense possibly damaging 0.95
R6841:Wdr59 UTSW 8 111496880 missense probably damaging 1.00
R6888:Wdr59 UTSW 8 111451043 missense probably benign 0.00
R6974:Wdr59 UTSW 8 111460788 missense possibly damaging 0.86
R6982:Wdr59 UTSW 8 111460813 missense probably benign 0.00
R7066:Wdr59 UTSW 8 111465845 missense probably benign 0.07
R7154:Wdr59 UTSW 8 111458735 missense
R7176:Wdr59 UTSW 8 111492756 missense
R7286:Wdr59 UTSW 8 111465862 missense
X0026:Wdr59 UTSW 8 111479340 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCTACGGAGATGCTATGGTAC -3'
(R):5'- CCAGCTTAAGCCATGGAGAG -3'

Sequencing Primer
(F):5'- TTGTTCTTCCACAGGGCCAGAG -3'
(R):5'- GGAAGATGGTAATGTAACTGATGTCC -3'
Posted On2016-10-24