Incidental Mutation 'R5540:Tbx4'
ID435907
Institutional Source Beutler Lab
Gene Symbol Tbx4
Ensembl Gene ENSMUSG00000000094
Gene NameT-box 4
Synonyms
MMRRC Submission 043098-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5540 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location85886422-85916097 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85911168 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 209 (N209I)
Ref Sequence ENSEMBL: ENSMUSP00000103682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000096] [ENSMUST00000108045] [ENSMUST00000108047]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000096
AA Change: N209I

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000000096
Gene: ENSMUSG00000000094
AA Change: N209I

DomainStartEndE-ValueType
TBOX 71 261 1.15e-126 SMART
Blast:TBOX 302 495 1e-122 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108045
AA Change: N109I

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103680
Gene: ENSMUSG00000000094
AA Change: N109I

DomainStartEndE-ValueType
TBOX 1 161 5e-86 SMART
Blast:TBOX 202 395 1e-122 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000108047
AA Change: N209I

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103682
Gene: ENSMUSG00000000094
AA Change: N209I

DomainStartEndE-ValueType
TBOX 71 261 1.15e-126 SMART
Blast:TBOX 302 495 1e-122 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is the human homolog of mouse Tbx4, which is closely linked to Tbx2 on mouse chromosome 11. Similarly this gene, like TBX2, maps to human chromosome 17. Expression studies in mouse and chicken show that Tbx4 is expressed in developing hindlimb, but not in forelimb buds, suggesting a role for this gene in regulating limb development and specification of limb identity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit stunted, apoptotic allantoises lacking vascular remodeling, fail to undergo chorioallantoic fusion, lack hindlimb buds, and die by embryonic day 10.5. Heterozygotes show mildly impaired allantois growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,362,947 S15P probably damaging Het
Actl7a A T 4: 56,744,388 H305L probably benign Het
Adam26b C A 8: 43,521,617 C116F probably damaging Het
Adgrl2 A G 3: 148,837,562 probably null Het
Akr1b10 A G 6: 34,394,112 T238A probably damaging Het
Akr1c18 A G 13: 4,137,179 V186A probably benign Het
Alpk3 G A 7: 81,095,436 V1311M probably damaging Het
Aox1 A G 1: 58,104,410 N1229S probably benign Het
Apobec3 T A 15: 79,897,919 N43K probably benign Het
Arid1a A C 4: 133,680,454 D2247E unknown Het
Asph A G 4: 9,635,906 L77S probably damaging Het
Cd300ld T A 11: 114,987,405 T94S probably damaging Het
Celf2 T C 2: 6,553,932 T382A probably benign Het
Cfap54 C T 10: 92,972,608 A1402T possibly damaging Het
Chrnb1 A T 11: 69,795,650 V48E probably benign Het
Col6a5 T A 9: 105,862,776 E2548V probably benign Het
Crebrf A G 17: 26,742,097 D56G possibly damaging Het
Dctn5 A G 7: 122,135,052 T40A probably benign Het
Dmxl2 A T 9: 54,393,857 N2323K probably benign Het
Dync1h1 A G 12: 110,660,950 Q4021R probably benign Het
Dyrk1a T G 16: 94,685,343 probably null Het
Ephb3 T A 16: 21,220,860 F454Y probably damaging Het
Fam71b A G 11: 46,404,888 N29S probably damaging Het
Fbxo38 A G 18: 62,514,793 probably null Het
Flg T C 3: 93,277,616 F15S probably damaging Het
Fndc3b G A 3: 27,501,502 P301L probably damaging Het
Fpr-rs7 C T 17: 20,114,094 G45R probably damaging Het
Gfi1 T A 5: 107,720,125 T360S probably damaging Het
Grik4 T C 9: 42,520,947 H918R probably damaging Het
Hpx A G 7: 105,591,912 S385P possibly damaging Het
Kdm5b A G 1: 134,631,241 D1501G probably damaging Het
Kif20b A T 19: 34,938,460 M546L probably benign Het
Map3k9 G T 12: 81,772,813 N222K probably damaging Het
Me1 A G 9: 86,679,873 L53P possibly damaging Het
Mis18bp1 T C 12: 65,148,746 E748G possibly damaging Het
Morc3 T A 16: 93,847,380 N186K probably benign Het
Mtor A G 4: 148,454,708 T221A probably benign Het
Muc6 A G 7: 141,649,585 probably null Het
Myh8 C A 11: 67,286,440 T444N probably benign Het
Myo7b A G 18: 32,007,090 Y216H probably damaging Het
Myom1 G A 17: 71,109,787 V1382M probably damaging Het
Nbeal2 A T 9: 110,631,733 Y1718N probably damaging Het
Npc1l1 A G 11: 6,214,546 S1168P probably damaging Het
Olfr1431 T A 19: 12,210,460 I298N probably damaging Het
Olfr463 T A 11: 87,893,685 K80* probably null Het
Olfr48 A G 2: 89,844,667 F102S probably damaging Het
Olfr561 C T 7: 102,774,929 A135V probably benign Het
Olfr765 G T 10: 129,046,495 D189E probably damaging Het
Pcdha4 C A 18: 36,954,837 A691E probably benign Het
Pde6a T G 18: 61,231,366 F165V probably damaging Het
Pqlc2 A T 4: 139,300,344 L229Q probably damaging Het
Ptpn14 A T 1: 189,846,364 M340L probably benign Het
Rnasel G T 1: 153,755,144 E469* probably null Het
Rsph3a T G 17: 7,945,958 L50R probably benign Het
Rusc2 A G 4: 43,423,975 Y1043C probably damaging Het
Serpinb6b A T 13: 32,977,558 K86* probably null Het
Serpine1 T C 5: 137,063,209 T392A probably benign Het
Shcbp1 A T 8: 4,744,529 D421E probably damaging Het
Slc24a1 A G 9: 64,948,581 V348A unknown Het
Slc26a7 A G 4: 14,506,621 F605L probably benign Het
Spag17 A C 3: 100,056,272 E1102A possibly damaging Het
Stab2 A G 10: 86,848,125 V2390A probably benign Het
Stk11 A G 10: 80,126,049 I35V probably benign Het
Stk24 T C 14: 121,294,281 D321G possibly damaging Het
Tmem225 T C 9: 40,149,385 L80P probably damaging Het
Tnfrsf4 C T 4: 156,013,923 T17I probably benign Het
Traf3ip1 G A 1: 91,501,315 R268Q probably benign Het
Trhde T A 10: 114,800,592 I237F probably benign Het
Ugt2a1 A T 5: 87,486,056 W231R probably damaging Het
Vash1 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 12: 86,680,057 probably benign Het
Vps16 T A 2: 130,442,385 D685E probably benign Het
Washc4 A G 10: 83,573,793 D602G probably damaging Het
Wdr59 A G 8: 111,485,184 L377P possibly damaging Het
Wdr81 T C 11: 75,449,070 E1364G probably damaging Het
Other mutations in Tbx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Tbx4 APN 11 85911943 missense probably damaging 1.00
IGL02113:Tbx4 APN 11 85912264 missense possibly damaging 0.82
IGL02172:Tbx4 APN 11 85914563 missense possibly damaging 0.83
IGL02440:Tbx4 APN 11 85890894 missense probably damaging 1.00
IGL02889:Tbx4 APN 11 85899795 nonsense probably null
IGL03380:Tbx4 APN 11 85914639 missense probably benign 0.00
R0332:Tbx4 UTSW 11 85898530 missense probably benign 0.06
R1772:Tbx4 UTSW 11 85911207 missense probably damaging 0.96
R1829:Tbx4 UTSW 11 85911920 intron probably null
R1907:Tbx4 UTSW 11 85914523 missense possibly damaging 0.79
R4470:Tbx4 UTSW 11 85912122 missense probably damaging 0.98
R5484:Tbx4 UTSW 11 85914404 missense probably damaging 0.99
R6962:Tbx4 UTSW 11 85890259 missense probably benign 0.01
R7355:Tbx4 UTSW 11 85912009 missense probably damaging 1.00
X0027:Tbx4 UTSW 11 85914383 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTAGAACAAGAGGCCAGGTG -3'
(R):5'- GCTCTGTTTCCCAGTATGGC -3'

Sequencing Primer
(F):5'- GAGTTGGGACCCCATTTCC -3'
(R):5'- CCCAGTATGGCAGTTTCTCTG -3'
Posted On2016-10-24