Incidental Mutation 'R5540:Crebrf'
ID435927
Institutional Source Beutler Lab
Gene Symbol Crebrf
Ensembl Gene ENSMUSG00000048249
Gene NameCREB3 regulatory factor
SynonymsA930001N09Rik
MMRRC Submission 043098-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.539) question?
Stock #R5540 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location26715650-26776635 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26742097 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 56 (D56G)
Ref Sequence ENSEMBL: ENSMUSP00000114274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062519] [ENSMUST00000142539] [ENSMUST00000144221] [ENSMUST00000151681]
Predicted Effect probably benign
Transcript: ENSMUST00000062519
AA Change: D64G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000059102
Gene: ENSMUSG00000048249
AA Change: D64G

DomainStartEndE-ValueType
low complexity region 317 330 N/A INTRINSIC
low complexity region 356 407 N/A INTRINSIC
Blast:BRLZ 520 584 3e-35 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132972
Predicted Effect possibly damaging
Transcript: ENSMUST00000142539
AA Change: D56G

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114274
Gene: ENSMUSG00000048249
AA Change: D56G

DomainStartEndE-ValueType
low complexity region 309 322 N/A INTRINSIC
low complexity region 348 399 N/A INTRINSIC
Blast:BRLZ 512 576 3e-35 BLAST
low complexity region 617 630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144221
AA Change: D64G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000120212
Gene: ENSMUSG00000048249
AA Change: D64G

DomainStartEndE-ValueType
low complexity region 317 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151681
SMART Domains Protein: ENSMUSP00000119186
Gene: ENSMUSG00000048249

DomainStartEndE-ValueType
Blast:BRLZ 100 137 2e-18 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired social recognition, increased vertical and horizontal activity, abnormal maternal nurturing, decreased prolactin and corticosterone serum levels, and abnormal mammary gland growth during lactation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,362,947 S15P probably damaging Het
Actl7a A T 4: 56,744,388 H305L probably benign Het
Adam26b C A 8: 43,521,617 C116F probably damaging Het
Adgrl2 A G 3: 148,837,562 probably null Het
Akr1b10 A G 6: 34,394,112 T238A probably damaging Het
Akr1c18 A G 13: 4,137,179 V186A probably benign Het
Alpk3 G A 7: 81,095,436 V1311M probably damaging Het
Aox1 A G 1: 58,104,410 N1229S probably benign Het
Apobec3 T A 15: 79,897,919 N43K probably benign Het
Arid1a A C 4: 133,680,454 D2247E unknown Het
Asph A G 4: 9,635,906 L77S probably damaging Het
Cd300ld T A 11: 114,987,405 T94S probably damaging Het
Celf2 T C 2: 6,553,932 T382A probably benign Het
Cfap54 C T 10: 92,972,608 A1402T possibly damaging Het
Chrnb1 A T 11: 69,795,650 V48E probably benign Het
Col6a5 T A 9: 105,862,776 E2548V probably benign Het
Dctn5 A G 7: 122,135,052 T40A probably benign Het
Dmxl2 A T 9: 54,393,857 N2323K probably benign Het
Dync1h1 A G 12: 110,660,950 Q4021R probably benign Het
Dyrk1a T G 16: 94,685,343 probably null Het
Ephb3 T A 16: 21,220,860 F454Y probably damaging Het
Fam71b A G 11: 46,404,888 N29S probably damaging Het
Fbxo38 A G 18: 62,514,793 probably null Het
Flg T C 3: 93,277,616 F15S probably damaging Het
Fndc3b G A 3: 27,501,502 P301L probably damaging Het
Fpr-rs7 C T 17: 20,114,094 G45R probably damaging Het
Gfi1 T A 5: 107,720,125 T360S probably damaging Het
Grik4 T C 9: 42,520,947 H918R probably damaging Het
Hpx A G 7: 105,591,912 S385P possibly damaging Het
Kdm5b A G 1: 134,631,241 D1501G probably damaging Het
Kif20b A T 19: 34,938,460 M546L probably benign Het
Map3k9 G T 12: 81,772,813 N222K probably damaging Het
Me1 A G 9: 86,679,873 L53P possibly damaging Het
Mis18bp1 T C 12: 65,148,746 E748G possibly damaging Het
Morc3 T A 16: 93,847,380 N186K probably benign Het
Mtor A G 4: 148,454,708 T221A probably benign Het
Muc6 A G 7: 141,649,585 probably null Het
Myh8 C A 11: 67,286,440 T444N probably benign Het
Myo7b A G 18: 32,007,090 Y216H probably damaging Het
Myom1 G A 17: 71,109,787 V1382M probably damaging Het
Nbeal2 A T 9: 110,631,733 Y1718N probably damaging Het
Npc1l1 A G 11: 6,214,546 S1168P probably damaging Het
Olfr1431 T A 19: 12,210,460 I298N probably damaging Het
Olfr463 T A 11: 87,893,685 K80* probably null Het
Olfr48 A G 2: 89,844,667 F102S probably damaging Het
Olfr561 C T 7: 102,774,929 A135V probably benign Het
Olfr765 G T 10: 129,046,495 D189E probably damaging Het
Pcdha4 C A 18: 36,954,837 A691E probably benign Het
Pde6a T G 18: 61,231,366 F165V probably damaging Het
Pqlc2 A T 4: 139,300,344 L229Q probably damaging Het
Ptpn14 A T 1: 189,846,364 M340L probably benign Het
Rnasel G T 1: 153,755,144 E469* probably null Het
Rsph3a T G 17: 7,945,958 L50R probably benign Het
Rusc2 A G 4: 43,423,975 Y1043C probably damaging Het
Serpinb6b A T 13: 32,977,558 K86* probably null Het
Serpine1 T C 5: 137,063,209 T392A probably benign Het
Shcbp1 A T 8: 4,744,529 D421E probably damaging Het
Slc24a1 A G 9: 64,948,581 V348A unknown Het
Slc26a7 A G 4: 14,506,621 F605L probably benign Het
Spag17 A C 3: 100,056,272 E1102A possibly damaging Het
Stab2 A G 10: 86,848,125 V2390A probably benign Het
Stk11 A G 10: 80,126,049 I35V probably benign Het
Stk24 T C 14: 121,294,281 D321G possibly damaging Het
Tbx4 A T 11: 85,911,168 N209I possibly damaging Het
Tmem225 T C 9: 40,149,385 L80P probably damaging Het
Tnfrsf4 C T 4: 156,013,923 T17I probably benign Het
Traf3ip1 G A 1: 91,501,315 R268Q probably benign Het
Trhde T A 10: 114,800,592 I237F probably benign Het
Ugt2a1 A T 5: 87,486,056 W231R probably damaging Het
Vash1 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 12: 86,680,057 probably benign Het
Vps16 T A 2: 130,442,385 D685E probably benign Het
Washc4 A G 10: 83,573,793 D602G probably damaging Het
Wdr59 A G 8: 111,485,184 L377P possibly damaging Het
Wdr81 T C 11: 75,449,070 E1364G probably damaging Het
Other mutations in Crebrf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Crebrf APN 17 26743093 missense probably damaging 1.00
IGL03106:Crebrf APN 17 26771319 missense probably damaging 1.00
R0046:Crebrf UTSW 17 26763334 missense probably damaging 1.00
R0046:Crebrf UTSW 17 26763334 missense probably damaging 1.00
R0254:Crebrf UTSW 17 26739594 missense probably benign 0.01
R0448:Crebrf UTSW 17 26743102 missense probably benign 0.42
R1268:Crebrf UTSW 17 26739596 frame shift probably null
R1857:Crebrf UTSW 17 26742963 missense probably benign 0.00
R1858:Crebrf UTSW 17 26742963 missense probably benign 0.00
R1937:Crebrf UTSW 17 26742468 missense probably damaging 1.00
R2005:Crebrf UTSW 17 26742883 missense possibly damaging 0.53
R2006:Crebrf UTSW 17 26742883 missense possibly damaging 0.53
R2031:Crebrf UTSW 17 26742921 missense probably damaging 0.97
R2323:Crebrf UTSW 17 26763607 unclassified probably benign
R2352:Crebrf UTSW 17 26742346 missense probably damaging 1.00
R4510:Crebrf UTSW 17 26742964 missense probably benign
R4511:Crebrf UTSW 17 26742964 missense probably benign
R4585:Crebrf UTSW 17 26762255 missense probably damaging 1.00
R4642:Crebrf UTSW 17 26743061 missense probably benign 0.23
R4896:Crebrf UTSW 17 26742420 missense possibly damaging 0.75
R5227:Crebrf UTSW 17 26759765 missense probably damaging 1.00
R5377:Crebrf UTSW 17 26759865 missense probably damaging 0.99
R5443:Crebrf UTSW 17 26742354 missense probably damaging 1.00
R6017:Crebrf UTSW 17 26757849 missense probably benign 0.04
R6132:Crebrf UTSW 17 26763403 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGGGCAAGGAAGCTATCATGTC -3'
(R):5'- TCATCTTGGTAAGGGCTAGAAAAGTC -3'

Sequencing Primer
(F):5'- GGAAGCTATCATGTCAGTAGCTTTTC -3'
(R):5'- GTCATCAAGACCCAGGTAATCC -3'
Posted On2016-10-24