Incidental Mutation 'R5541:0610009B22Rik'
List |< first << previous [record 9 of 386652] next >> last >|
ID435978
Institutional Source Beutler Lab
Gene Symbol 0610009B22Rik
Ensembl Gene ENSMUSG00000007777
Gene NameRIKEN cDNA 0610009B22 gene
Synonyms
Accession Numbers
Stock #R5541 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location51685386-51688874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51685969 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 34 (H34R)
Ref Sequence ENSEMBL: ENSMUSP00000007921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007921] [ENSMUST00000109098]
Predicted Effect probably benign
Transcript: ENSMUST00000007921
AA Change: H34R

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000007921
Gene: ENSMUSG00000007777
AA Change: H34R

DomainStartEndE-ValueType
Pfam:Sedlin_N 9 136 7.3e-52 PFAM
Pfam:Sybindin 46 137 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109098
AA Change: H34R

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104726
Gene: ENSMUSG00000007777
AA Change: H34R

DomainStartEndE-ValueType
Pfam:Sedlin_N 9 136 1e-50 PFAM
Pfam:Sybindin 46 137 1.4e-11 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,225,946 K86R probably benign Het
2310003H01Rik T A 11: 120,377,632 E105V possibly damaging Het
Abca13 T C 11: 9,291,545 V1136A probably benign Het
Ankrd12 A G 17: 65,982,839 L39P noncoding transcript Het
Arfgap2 G A 2: 91,275,769 R530H probably benign Het
Arhgap30 T C 1: 171,404,139 probably null Het
Asb7 T C 7: 66,679,269 R8G probably benign Het
Bod1l T C 5: 41,791,933 N2949D probably benign Het
Ccdc171 A T 4: 83,696,283 H65L noncoding transcript Het
Ccdc86 T C 19: 10,948,554 E227G probably damaging Het
Cercam A G 2: 29,875,629 D261G probably benign Het
Chd9 A T 8: 91,051,504 E2714D probably benign Het
Dcp1a T A 14: 30,502,839 S126R probably damaging Het
Defa17 T A 8: 21,656,549 C64S probably damaging Het
Depdc5 A T 5: 32,864,629 I140F noncoding transcript Het
Dnah6 A T 6: 73,192,988 L323Q possibly damaging Het
Dnah9 T C 11: 66,145,336 Y416C probably damaging Het
Fbxw15 T G 9: 109,565,430 I106L probably benign Het
Gm10610 A G 7: 83,549,406 C75R unknown Het
Gm14411 T A 2: 177,125,847 N177I noncoding transcript Het
Gpr22 A G 12: 31,709,349 F258S probably damaging Het
Grip1 A T 10: 120,072,718 I966F probably damaging Het
H2afy2 T C 10: 61,747,717 I215V probably benign Het
Hspg2 C T 4: 137,520,551 T1233I probably damaging Het
Hspg2 C A 4: 137,542,825 Q2365K probably benign Het
Intu A G 3: 40,692,587 D630G probably damaging Het
Kdm1b T C 13: 47,079,196 M714T probably damaging Het
Kif21a A G 15: 90,968,113 M924T probably damaging Het
Klb A T 5: 65,379,234 M636L probably benign Het
Klrb1a G A 6: 128,609,736 H222Y probably benign Het
March10 C T 11: 105,390,131 D443N probably damaging Het
Nos1 A G 5: 117,905,394 E578G probably damaging Het
Olfr1502 T C 19: 13,861,964 I57T probably benign Het
Olfr887 T C 9: 38,085,123 C96R probably damaging Het
Pard3b A G 1: 61,639,343 Y34C probably damaging Het
Pcdh17 T A 14: 84,447,416 V441E probably damaging Het
Pde6g A T 11: 120,448,172 I64N probably damaging Het
Pdia4 C T 6: 47,796,637 V593M probably damaging Het
Pnn T G 12: 59,071,930 V433G possibly damaging Het
Ptbp1 A G 10: 79,863,211 T588A noncoding transcript Het
Rbak G A 5: 143,173,990 S436F probably damaging Het
Rpl11 A G 4: 136,052,732 C89R noncoding transcript Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Smg1 T A 7: 118,157,163 M2248L probably benign Het
St8sia2 T C 7: 73,966,900 D109G probably benign Het
Stk-ps1 T A 17: 36,398,213 D102V noncoding transcript Het
Stxbp3-ps C T 19: 9,557,970 E194K noncoding transcript Het
Taf1d T A 9: 15,308,850 F132I probably damaging Het
Tfap2b A G 1: 19,214,026 S35G possibly damaging Het
Tnfaip3 A G 10: 19,002,923 V1402A noncoding transcript Het
Tnk2 C T 16: 32,669,523 T198I probably benign Het
Ube2q2 T A 9: 55,191,879 V291E possibly damaging Het
Ucma A G 2: 4,981,330 R105G probably benign Het
Wapal T C 14: 34,730,662 probably null Het
Zfand4 T A 6: 116,314,295 C272S probably benign Het
Zfhx3 A G 8: 108,948,951 N2211S probably damaging Het
Zfp568 T A 7: 30,022,876 D414E possibly damaging Het
Zfp574 C T 7: 25,081,950 A799V probably damaging Het
Other mutations in 0610009B22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:0610009B22Rik APN 11 51685843 missense probably damaging 0.99
R1657:0610009B22Rik UTSW 11 51685678 missense probably benign 0.00
R5157:0610009B22Rik UTSW 11 51686066 missense probably benign
R5387:0610009B22Rik UTSW 11 51685974 missense probably benign
R5649:0610009B22Rik UTSW 11 51685972 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGTTCATAAAAGGGATTCATGGC -3'
(R):5'- GAATTTCATGAACTGACTTGGGG -3'

Sequencing Primer
(F):5'- GAAGAAGTTCTTGATGCCATCCTCG -3'
(R):5'- AACTGACTTGGGGTTCATTTGC -3'
Posted OnOct 24, 2016