Incidental Mutation 'R5542:Trip12'
ID435998
Institutional Source Beutler Lab
Gene Symbol Trip12
Ensembl Gene ENSMUSG00000026219
Gene Namethyroid hormone receptor interactor 12
Synonyms6720416K24Rik, 1110036I07Rik, Gtl6
MMRRC Submission 043100-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5542 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location84721189-84840516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84749344 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1135 (D1135E)
Ref Sequence ENSEMBL: ENSMUSP00000139563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000189670] [ENSMUST00000189841]
Predicted Effect probably damaging
Transcript: ENSMUST00000027421
AA Change: D1168E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: D1168E

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 765 831 7.6e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185909
SMART Domains Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219

DomainStartEndE-ValueType
low complexity region 195 214 N/A INTRINSIC
low complexity region 219 230 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186465
AA Change: D1168E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: D1168E

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 761 831 2.2e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186648
AA Change: D1135E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: D1135E

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
SCOP:d1ee4a_ 440 654 5e-20 SMART
PDB:1WA5|B 441 635 1e-5 PDB
low complexity region 950 973 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1312 1329 N/A INTRINSIC
Blast:HECTc 1330 1384 7e-8 BLAST
Blast:HECTc 1540 1596 2e-24 BLAST
HECTc 1603 1992 6.2e-180 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189670
SMART Domains Protein: ENSMUSP00000140789
Gene: ENSMUSG00000026219

DomainStartEndE-ValueType
low complexity region 138 149 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
Blast:HECTc 168 222 5e-8 BLAST
Blast:HECTc 378 434 1e-24 BLAST
HECTc 441 830 6.2e-180 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189841
SMART Domains Protein: ENSMUSP00000140879
Gene: ENSMUSG00000026219

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 51 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190125
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,435 V106D probably damaging Het
9530053A07Rik A T 7: 28,155,489 I1847F probably damaging Het
Aadacl2 C T 3: 60,025,063 T333I probably damaging Het
Acacb C T 5: 114,195,737 R574C probably damaging Het
Actr10 T C 12: 70,954,656 probably benign Het
Ankdd1a T A 9: 65,504,190 probably null Het
Anks4b C T 7: 120,182,423 Q226* probably null Het
AW146154 C A 7: 41,481,377 G105V probably benign Het
Ccdc129 C A 6: 55,978,395 P996Q probably damaging Het
Cdh4 T A 2: 179,860,226 N326K probably damaging Het
Cnbd1 T C 4: 18,860,517 T410A possibly damaging Het
Cndp2 A T 18: 84,672,076 M247K probably damaging Het
Crx G A 7: 15,868,337 R139C probably damaging Het
Ctrc A G 4: 141,843,726 Y68H probably damaging Het
Ddx4 T C 13: 112,621,245 D326G probably damaging Het
Edem1 C T 6: 108,854,329 R584C possibly damaging Het
Emcn A G 3: 137,379,877 T79A probably benign Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Fbrsl1 C T 5: 110,378,441 G437R probably damaging Het
Fbxo7 A C 10: 86,033,285 Q201P probably benign Het
Fbxo9 T C 9: 78,101,656 M12V possibly damaging Het
Flii A G 11: 60,718,862 S640P probably benign Het
Fsip2 A T 2: 82,981,863 N2842I possibly damaging Het
Fst G T 13: 114,455,705 Q159K probably damaging Het
Fuom A T 7: 140,100,112 *109R probably null Het
Gm9573 T C 17: 35,622,503 probably benign Het
Gm9992 A T 17: 7,369,788 C334S probably benign Het
Hhipl2 A G 1: 183,433,146 D377G probably damaging Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Ighm A G 12: 113,418,981 probably benign Het
Ighv1-85 T A 12: 116,000,227 Y51F probably benign Het
Ighv2-3 A T 12: 113,611,213 D107E probably benign Het
Ighv2-6-8 T A 12: 113,796,567 M1L probably benign Het
Ipo5 T C 14: 120,926,271 V247A probably benign Het
Itga9 T C 9: 118,843,661 F154L possibly damaging Het
Knl1 T A 2: 119,068,348 C177S possibly damaging Het
Lrrc17 G A 5: 21,575,158 G377S probably damaging Het
Marveld3 A T 8: 109,948,617 I189K probably benign Het
Msantd2 G A 9: 37,517,259 G185R probably damaging Het
Mtcl1 G A 17: 66,384,359 probably benign Het
Mycbpap A T 11: 94,507,746 probably null Het
Nbeal1 A G 1: 60,277,194 D1852G probably benign Het
Ndc80 A T 17: 71,500,281 V560D probably benign Het
Olfr1505 T C 19: 13,919,047 V9A probably benign Het
Olfr2 A T 7: 107,001,079 S260R probably damaging Het
Olfr330 A C 11: 58,529,884 V34G probably benign Het
Olfr384 T A 11: 73,603,204 V208E possibly damaging Het
Olfr679 A T 7: 105,086,358 D214V probably damaging Het
Pcdhga4 A T 18: 37,686,598 Y400F probably damaging Het
Pkd2 A G 5: 104,486,649 silent Het
Plxna4 T A 6: 32,206,230 I913F probably damaging Het
Psmc1 T C 12: 100,120,140 probably null Het
Robo2 G A 16: 73,898,965 T1430I probably benign Het
Safb2 G A 17: 56,575,647 R329C probably damaging Het
Sept14 T C 5: 129,697,862 H83R probably damaging Het
Slc16a10 A G 10: 40,076,788 F237L probably benign Het
Slc37a1 A T 17: 31,340,262 T439S probably damaging Het
Slc6a6 T C 6: 91,735,189 F233S probably damaging Het
Smyd3 A T 1: 179,410,459 D114E probably benign Het
Sned1 T C 1: 93,271,602 I468T probably benign Het
Speer4a T A 5: 26,036,738 N130I probably damaging Het
Tdrd7 T C 4: 46,029,757 V1030A probably benign Het
Tsga10 T A 1: 37,761,517 D542V probably damaging Het
Ubqlnl G A 7: 104,149,697 Q198* probably null Het
Usp46 A T 5: 74,029,241 M43K probably benign Het
Vmn1r175 A T 7: 23,809,106 I32N possibly damaging Het
Vmn1r29 C T 6: 58,308,123 T276I probably benign Het
Vmn1r81 A T 7: 12,260,107 D191E probably damaging Het
Zbtb5 C A 4: 44,995,052 V111F probably damaging Het
Zfp12 C T 5: 143,244,485 P189L possibly damaging Het
Zfp729b A G 13: 67,591,021 F1042L probably benign Het
Other mutations in Trip12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Trip12 APN 1 84730541 missense probably damaging 1.00
IGL00430:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00465:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00819:Trip12 APN 1 84754272 missense probably damaging 1.00
IGL00900:Trip12 APN 1 84724764 missense possibly damaging 0.56
IGL00990:Trip12 APN 1 84751884 missense probably damaging 0.99
IGL01087:Trip12 APN 1 84757859 missense probably damaging 0.99
IGL01400:Trip12 APN 1 84751978 missense probably damaging 0.99
IGL01521:Trip12 APN 1 84766198 splice site probably benign
IGL01619:Trip12 APN 1 84814910 missense probably damaging 0.99
IGL01796:Trip12 APN 1 84728278 missense probably benign 0.42
IGL01975:Trip12 APN 1 84814813 splice site probably benign
IGL02190:Trip12 APN 1 84766070 missense probably damaging 0.98
IGL02474:Trip12 APN 1 84794133 missense probably benign
IGL02517:Trip12 APN 1 84743814 unclassified probably benign
IGL02631:Trip12 APN 1 84766008 missense possibly damaging 0.91
IGL02991:Trip12 APN 1 84738815 missense probably damaging 1.00
IGL03161:Trip12 APN 1 84761132 unclassified probably benign
IGL03388:Trip12 APN 1 84743186 missense probably damaging 0.99
cardamom UTSW 1 84749276 missense probably damaging 0.99
turmeric UTSW 1 84754343 missense probably benign 0.07
LCD18:Trip12 UTSW 1 84754482 unclassified probably benign
R0090:Trip12 UTSW 1 84732136 splice site probably benign
R0111:Trip12 UTSW 1 84759133 unclassified probably benign
R0471:Trip12 UTSW 1 84726207 missense probably damaging 1.00
R0486:Trip12 UTSW 1 84761084 nonsense probably null
R0557:Trip12 UTSW 1 84724747 missense probably damaging 1.00
R0570:Trip12 UTSW 1 84751548 missense probably damaging 1.00
R0614:Trip12 UTSW 1 84757761 missense probably damaging 1.00
R0627:Trip12 UTSW 1 84768597 missense probably damaging 1.00
R0630:Trip12 UTSW 1 84793915 missense possibly damaging 0.70
R0657:Trip12 UTSW 1 84759050 missense probably benign 0.19
R0741:Trip12 UTSW 1 84745181 missense probably benign 0.09
R0862:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R0864:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R1124:Trip12 UTSW 1 84737037 missense probably damaging 1.00
R1252:Trip12 UTSW 1 84776350 nonsense probably null
R1455:Trip12 UTSW 1 84759100 missense probably benign 0.01
R1487:Trip12 UTSW 1 84768631 missense probably damaging 1.00
R1702:Trip12 UTSW 1 84745063 missense probably damaging 1.00
R1781:Trip12 UTSW 1 84730621 missense probably benign 0.01
R1847:Trip12 UTSW 1 84749269 missense probably damaging 1.00
R1854:Trip12 UTSW 1 84728145 missense probably damaging 1.00
R1866:Trip12 UTSW 1 84745060 missense probably damaging 1.00
R1926:Trip12 UTSW 1 84749291 missense probably damaging 0.98
R1935:Trip12 UTSW 1 84794101 missense possibly damaging 0.46
R1950:Trip12 UTSW 1 84760801 missense probably damaging 1.00
R1994:Trip12 UTSW 1 84749172 missense probably damaging 1.00
R2014:Trip12 UTSW 1 84760866 nonsense probably null
R2391:Trip12 UTSW 1 84814790 frame shift probably null
R2423:Trip12 UTSW 1 84814790 frame shift probably null
R2433:Trip12 UTSW 1 84743823 missense possibly damaging 0.84
R2905:Trip12 UTSW 1 84754343 missense probably benign 0.07
R3040:Trip12 UTSW 1 84742245 missense probably benign 0.13
R3735:Trip12 UTSW 1 84814790 frame shift probably null
R3907:Trip12 UTSW 1 84732106 missense possibly damaging 0.53
R4394:Trip12 UTSW 1 84725741 missense probably damaging 1.00
R4540:Trip12 UTSW 1 84749276 missense probably damaging 0.99
R4859:Trip12 UTSW 1 84793810 missense probably damaging 0.99
R5240:Trip12 UTSW 1 84794133 missense probably benign
R5278:Trip12 UTSW 1 84762147 missense probably damaging 1.00
R5377:Trip12 UTSW 1 84757431 missense probably damaging 1.00
R5510:Trip12 UTSW 1 84768680 missense probably damaging 1.00
R5550:Trip12 UTSW 1 84761099 missense probably damaging 0.99
R5886:Trip12 UTSW 1 84730458 intron probably benign
R5893:Trip12 UTSW 1 84759163 unclassified probably benign
R5914:Trip12 UTSW 1 84763458 missense probably damaging 1.00
R5925:Trip12 UTSW 1 84749253 nonsense probably null
R5985:Trip12 UTSW 1 84725771 missense probably damaging 0.99
R6135:Trip12 UTSW 1 84760838 missense probably benign 0.00
R6158:Trip12 UTSW 1 84761012 missense possibly damaging 0.84
R6419:Trip12 UTSW 1 84793870 missense probably damaging 1.00
R6816:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7144:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7194:Trip12 UTSW 1 84794222 missense probably benign 0.07
X0023:Trip12 UTSW 1 84760787 missense probably benign 0.12
X0065:Trip12 UTSW 1 84749163 missense probably benign 0.21
Z1088:Trip12 UTSW 1 84766168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAAGGAAACGTTTTAACCGG -3'
(R):5'- ACATAGTGACCCTTCCAGATAATG -3'

Sequencing Primer
(F):5'- GGAAACGTTTTAACCGGATCTCTCTG -3'
(R):5'- GATCTAAGCCCAGTAGTGCTCTAG -3'
Posted On2016-10-24