Incidental Mutation 'R5542:Lrrc17'
ID436017
Institutional Source Beutler Lab
Gene Symbol Lrrc17
Ensembl Gene ENSMUSG00000039883
Gene Nameleucine rich repeat containing 17
Synonyms6130400C22Rik, 37kDa, 4833425M04Rik
MMRRC Submission 043100-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5542 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location21543559-21575904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21575158 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 377 (G377S)
Ref Sequence ENSEMBL: ENSMUSP00000038569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035651] [ENSMUST00000051358] [ENSMUST00000115234]
Predicted Effect probably damaging
Transcript: ENSMUST00000035651
AA Change: G377S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038569
Gene: ENSMUSG00000039883
AA Change: G377S

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
Blast:LRR 83 105 8e-6 BLAST
LRR 106 129 9.96e-1 SMART
LRR 130 153 1.07e0 SMART
LRRCT 165 215 8.98e-4 SMART
LRR 270 292 8.73e1 SMART
LRR 293 316 3.52e-1 SMART
LRR 317 340 7.55e-1 SMART
LRRCT 352 403 8.95e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051358
SMART Domains Protein: ENSMUSP00000052716
Gene: ENSMUSG00000048520

DomainStartEndE-ValueType
low complexity region 160 173 N/A INTRINSIC
FBOX 243 283 3.73e-4 SMART
LRR_CC 328 353 6.62e-6 SMART
LRR 354 378 3.67e2 SMART
LRR 379 404 2.75e-3 SMART
LRR 407 425 4.51e2 SMART
LRR 426 451 2.63e0 SMART
LRR 476 501 4.15e1 SMART
LRR 502 526 1.82e1 SMART
LRR 529 554 1.76e-1 SMART
LRR_CC 555 580 4.61e-5 SMART
LRR 604 629 8.81e-2 SMART
LRR 630 655 2.37e1 SMART
LRR 656 681 3.21e-4 SMART
LRR 682 707 6.57e-1 SMART
LRR 708 733 9.47e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115234
SMART Domains Protein: ENSMUSP00000110889
Gene: ENSMUSG00000048520

DomainStartEndE-ValueType
low complexity region 160 173 N/A INTRINSIC
FBOX 243 283 3.73e-4 SMART
LRR_CC 328 353 6.62e-6 SMART
LRR 354 378 3.67e2 SMART
LRR 379 404 2.75e-3 SMART
LRR 407 432 6.88e-4 SMART
Blast:LRR 433 458 7e-8 BLAST
LRR 459 484 2.63e0 SMART
LRR 509 534 4.15e1 SMART
LRR 535 559 1.82e1 SMART
LRR 562 587 1.76e-1 SMART
LRR_CC 588 613 4.61e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137788
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,435 V106D probably damaging Het
9530053A07Rik A T 7: 28,155,489 I1847F probably damaging Het
Aadacl2 C T 3: 60,025,063 T333I probably damaging Het
Acacb C T 5: 114,195,737 R574C probably damaging Het
Actr10 T C 12: 70,954,656 probably benign Het
Ankdd1a T A 9: 65,504,190 probably null Het
Anks4b C T 7: 120,182,423 Q226* probably null Het
AW146154 C A 7: 41,481,377 G105V probably benign Het
Ccdc129 C A 6: 55,978,395 P996Q probably damaging Het
Cdh4 T A 2: 179,860,226 N326K probably damaging Het
Cnbd1 T C 4: 18,860,517 T410A possibly damaging Het
Cndp2 A T 18: 84,672,076 M247K probably damaging Het
Crx G A 7: 15,868,337 R139C probably damaging Het
Ctrc A G 4: 141,843,726 Y68H probably damaging Het
Ddx4 T C 13: 112,621,245 D326G probably damaging Het
Edem1 C T 6: 108,854,329 R584C possibly damaging Het
Emcn A G 3: 137,379,877 T79A probably benign Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Fbrsl1 C T 5: 110,378,441 G437R probably damaging Het
Fbxo7 A C 10: 86,033,285 Q201P probably benign Het
Fbxo9 T C 9: 78,101,656 M12V possibly damaging Het
Flii A G 11: 60,718,862 S640P probably benign Het
Fsip2 A T 2: 82,981,863 N2842I possibly damaging Het
Fst G T 13: 114,455,705 Q159K probably damaging Het
Fuom A T 7: 140,100,112 *109R probably null Het
Gm9573 T C 17: 35,622,503 probably benign Het
Gm9992 A T 17: 7,369,788 C334S probably benign Het
Hhipl2 A G 1: 183,433,146 D377G probably damaging Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Ighm A G 12: 113,418,981 probably benign Het
Ighv1-85 T A 12: 116,000,227 Y51F probably benign Het
Ighv2-3 A T 12: 113,611,213 D107E probably benign Het
Ighv2-6-8 T A 12: 113,796,567 M1L probably benign Het
Ipo5 T C 14: 120,926,271 V247A probably benign Het
Itga9 T C 9: 118,843,661 F154L possibly damaging Het
Knl1 T A 2: 119,068,348 C177S possibly damaging Het
Marveld3 A T 8: 109,948,617 I189K probably benign Het
Msantd2 G A 9: 37,517,259 G185R probably damaging Het
Mtcl1 G A 17: 66,384,359 probably benign Het
Mycbpap A T 11: 94,507,746 probably null Het
Nbeal1 A G 1: 60,277,194 D1852G probably benign Het
Ndc80 A T 17: 71,500,281 V560D probably benign Het
Olfr1505 T C 19: 13,919,047 V9A probably benign Het
Olfr2 A T 7: 107,001,079 S260R probably damaging Het
Olfr330 A C 11: 58,529,884 V34G probably benign Het
Olfr384 T A 11: 73,603,204 V208E possibly damaging Het
Olfr679 A T 7: 105,086,358 D214V probably damaging Het
Pcdhga4 A T 18: 37,686,598 Y400F probably damaging Het
Pkd2 A G 5: 104,486,649 silent Het
Plxna4 T A 6: 32,206,230 I913F probably damaging Het
Psmc1 T C 12: 100,120,140 probably null Het
Robo2 G A 16: 73,898,965 T1430I probably benign Het
Safb2 G A 17: 56,575,647 R329C probably damaging Het
Sept14 T C 5: 129,697,862 H83R probably damaging Het
Slc16a10 A G 10: 40,076,788 F237L probably benign Het
Slc37a1 A T 17: 31,340,262 T439S probably damaging Het
Slc6a6 T C 6: 91,735,189 F233S probably damaging Het
Smyd3 A T 1: 179,410,459 D114E probably benign Het
Sned1 T C 1: 93,271,602 I468T probably benign Het
Speer4a T A 5: 26,036,738 N130I probably damaging Het
Tdrd7 T C 4: 46,029,757 V1030A probably benign Het
Trip12 A T 1: 84,749,344 D1135E probably damaging Het
Tsga10 T A 1: 37,761,517 D542V probably damaging Het
Ubqlnl G A 7: 104,149,697 Q198* probably null Het
Usp46 A T 5: 74,029,241 M43K probably benign Het
Vmn1r175 A T 7: 23,809,106 I32N possibly damaging Het
Vmn1r29 C T 6: 58,308,123 T276I probably benign Het
Vmn1r81 A T 7: 12,260,107 D191E probably damaging Het
Zbtb5 C A 4: 44,995,052 V111F probably damaging Het
Zfp12 C T 5: 143,244,485 P189L possibly damaging Het
Zfp729b A G 13: 67,591,021 F1042L probably benign Het
Other mutations in Lrrc17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Lrrc17 APN 5 21575271 missense probably benign 0.05
IGL01289:Lrrc17 APN 5 21560901 missense probably damaging 1.00
IGL01549:Lrrc17 APN 5 21570290 missense probably benign 0.00
IGL02105:Lrrc17 APN 5 21570257 missense probably benign 0.30
IGL02371:Lrrc17 APN 5 21560996 missense probably damaging 1.00
IGL02412:Lrrc17 APN 5 21560879 missense possibly damaging 0.68
IGL02587:Lrrc17 APN 5 21561080 missense probably damaging 1.00
R0255:Lrrc17 UTSW 5 21560969 missense probably benign 0.09
R0504:Lrrc17 UTSW 5 21560530 missense probably benign 0.05
R0883:Lrrc17 UTSW 5 21561278 missense probably benign 0.06
R1875:Lrrc17 UTSW 5 21560652 missense possibly damaging 0.85
R2168:Lrrc17 UTSW 5 21575048 missense probably damaging 0.97
R5057:Lrrc17 UTSW 5 21575309 missense probably benign 0.25
R5326:Lrrc17 UTSW 5 21575158 missense probably damaging 0.99
R5574:Lrrc17 UTSW 5 21570357 missense possibly damaging 0.90
R5872:Lrrc17 UTSW 5 21575266 missense probably benign 0.01
R7108:Lrrc17 UTSW 5 21575339 missense possibly damaging 0.93
X0026:Lrrc17 UTSW 5 21561020 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCATACACCTAGAAGAGCTCG -3'
(R):5'- GGGACGGTTCGGTAGTTAAC -3'

Sequencing Primer
(F):5'- TACACCTAGAAGAGCTCGACTTATC -3'
(R):5'- GTAGTTAACTACCCCACAATGGTG -3'
Posted On2016-10-24