Incidental Mutation 'R5542:Speer4a'
ID436018
Institutional Source Beutler Lab
Gene Symbol Speer4a
Ensembl Gene ENSMUSG00000073119
Gene Namespermatogenesis associated glutamate (E)-rich protein 4A
Synonyms1700027N01Rik, SPEER-4A
MMRRC Submission 043100-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R5542 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location26032846-26039558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26036738 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 130 (N130I)
Ref Sequence ENSEMBL: ENSMUSP00000078415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079447]
Predicted Effect probably damaging
Transcript: ENSMUST00000079447
AA Change: N130I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078415
Gene: ENSMUSG00000073119
AA Change: N130I

DomainStartEndE-ValueType
Pfam:Takusan 50 134 1.7e-26 PFAM
low complexity region 135 146 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 183 223 N/A INTRINSIC
low complexity region 248 261 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,435 V106D probably damaging Het
9530053A07Rik A T 7: 28,155,489 I1847F probably damaging Het
Aadacl2 C T 3: 60,025,063 T333I probably damaging Het
Acacb C T 5: 114,195,737 R574C probably damaging Het
Actr10 T C 12: 70,954,656 probably benign Het
Ankdd1a T A 9: 65,504,190 probably null Het
Anks4b C T 7: 120,182,423 Q226* probably null Het
AW146154 C A 7: 41,481,377 G105V probably benign Het
Ccdc129 C A 6: 55,978,395 P996Q probably damaging Het
Cdh4 T A 2: 179,860,226 N326K probably damaging Het
Cnbd1 T C 4: 18,860,517 T410A possibly damaging Het
Cndp2 A T 18: 84,672,076 M247K probably damaging Het
Crx G A 7: 15,868,337 R139C probably damaging Het
Ctrc A G 4: 141,843,726 Y68H probably damaging Het
Ddx4 T C 13: 112,621,245 D326G probably damaging Het
Edem1 C T 6: 108,854,329 R584C possibly damaging Het
Emcn A G 3: 137,379,877 T79A probably benign Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Fbrsl1 C T 5: 110,378,441 G437R probably damaging Het
Fbxo7 A C 10: 86,033,285 Q201P probably benign Het
Fbxo9 T C 9: 78,101,656 M12V possibly damaging Het
Flii A G 11: 60,718,862 S640P probably benign Het
Fsip2 A T 2: 82,981,863 N2842I possibly damaging Het
Fst G T 13: 114,455,705 Q159K probably damaging Het
Fuom A T 7: 140,100,112 *109R probably null Het
Gm9573 T C 17: 35,622,503 probably benign Het
Gm9992 A T 17: 7,369,788 C334S probably benign Het
Hhipl2 A G 1: 183,433,146 D377G probably damaging Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Ighm A G 12: 113,418,981 probably benign Het
Ighv1-85 T A 12: 116,000,227 Y51F probably benign Het
Ighv2-3 A T 12: 113,611,213 D107E probably benign Het
Ighv2-6-8 T A 12: 113,796,567 M1L probably benign Het
Ipo5 T C 14: 120,926,271 V247A probably benign Het
Itga9 T C 9: 118,843,661 F154L possibly damaging Het
Knl1 T A 2: 119,068,348 C177S possibly damaging Het
Lrrc17 G A 5: 21,575,158 G377S probably damaging Het
Marveld3 A T 8: 109,948,617 I189K probably benign Het
Msantd2 G A 9: 37,517,259 G185R probably damaging Het
Mtcl1 G A 17: 66,384,359 probably benign Het
Mycbpap A T 11: 94,507,746 probably null Het
Nbeal1 A G 1: 60,277,194 D1852G probably benign Het
Ndc80 A T 17: 71,500,281 V560D probably benign Het
Olfr1505 T C 19: 13,919,047 V9A probably benign Het
Olfr2 A T 7: 107,001,079 S260R probably damaging Het
Olfr330 A C 11: 58,529,884 V34G probably benign Het
Olfr384 T A 11: 73,603,204 V208E possibly damaging Het
Olfr679 A T 7: 105,086,358 D214V probably damaging Het
Pcdhga4 A T 18: 37,686,598 Y400F probably damaging Het
Pkd2 A G 5: 104,486,649 silent Het
Plxna4 T A 6: 32,206,230 I913F probably damaging Het
Psmc1 T C 12: 100,120,140 probably null Het
Robo2 G A 16: 73,898,965 T1430I probably benign Het
Safb2 G A 17: 56,575,647 R329C probably damaging Het
Sept14 T C 5: 129,697,862 H83R probably damaging Het
Slc16a10 A G 10: 40,076,788 F237L probably benign Het
Slc37a1 A T 17: 31,340,262 T439S probably damaging Het
Slc6a6 T C 6: 91,735,189 F233S probably damaging Het
Smyd3 A T 1: 179,410,459 D114E probably benign Het
Sned1 T C 1: 93,271,602 I468T probably benign Het
Tdrd7 T C 4: 46,029,757 V1030A probably benign Het
Trip12 A T 1: 84,749,344 D1135E probably damaging Het
Tsga10 T A 1: 37,761,517 D542V probably damaging Het
Ubqlnl G A 7: 104,149,697 Q198* probably null Het
Usp46 A T 5: 74,029,241 M43K probably benign Het
Vmn1r175 A T 7: 23,809,106 I32N possibly damaging Het
Vmn1r29 C T 6: 58,308,123 T276I probably benign Het
Vmn1r81 A T 7: 12,260,107 D191E probably damaging Het
Zbtb5 C A 4: 44,995,052 V111F probably damaging Het
Zfp12 C T 5: 143,244,485 P189L possibly damaging Het
Zfp729b A G 13: 67,591,021 F1042L probably benign Het
Other mutations in Speer4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Speer4a APN 5 26035047 missense possibly damaging 0.95
IGL01959:Speer4a APN 5 26035904 nonsense probably null
IGL02294:Speer4a APN 5 26038242 missense probably benign 0.21
FR4340:Speer4a UTSW 5 26036748 nonsense probably null
FR4342:Speer4a UTSW 5 26036748 nonsense probably null
FR4589:Speer4a UTSW 5 26036748 nonsense probably null
R0137:Speer4a UTSW 5 26035984 missense possibly damaging 0.95
R1068:Speer4a UTSW 5 26036026 missense probably null 0.84
R1209:Speer4a UTSW 5 26035125 critical splice acceptor site probably null
R3805:Speer4a UTSW 5 26035084 missense possibly damaging 0.76
R4525:Speer4a UTSW 5 26039343 critical splice donor site probably null
R4851:Speer4a UTSW 5 26038212 missense probably damaging 0.99
R5326:Speer4a UTSW 5 26036738 missense probably damaging 0.99
R6081:Speer4a UTSW 5 26034962 nonsense probably null
R6742:Speer4a UTSW 5 26036056 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGCCTAGGAAAACTGAGTCC -3'
(R):5'- TAGAATGCAGAGTGTGGTTTCC -3'

Sequencing Primer
(F):5'- ATCCAAGGCAAACTGATGGC -3'
(R):5'- TTCCATGGCTGCAGTAGTCCAG -3'
Posted On2016-10-24