Incidental Mutation 'R5542:Usp46'
ID436019
Institutional Source Beutler Lab
Gene Symbol Usp46
Ensembl Gene ENSMUSG00000054814
Gene Nameubiquitin specific peptidase 46
Synonyms1190009E20Rik, 2410018I08Rik
MMRRC Submission 043100-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R5542 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location73998453-74068431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74029241 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 43 (M43K)
Ref Sequence ENSEMBL: ENSMUSP00000144284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068058] [ENSMUST00000119154] [ENSMUST00000145016] [ENSMUST00000152408]
Predicted Effect probably benign
Transcript: ENSMUST00000068058
AA Change: M154K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000070554
Gene: ENSMUSG00000054814
AA Change: M154K

DomainStartEndE-ValueType
Pfam:UCH 34 362 6.8e-67 PFAM
Pfam:UCH_1 35 335 1.5e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119154
AA Change: M127K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114060
Gene: ENSMUSG00000054814
AA Change: M127K

DomainStartEndE-ValueType
Pfam:UCH 9 335 4.1e-67 PFAM
Pfam:UCH_1 11 308 2.9e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129275
Predicted Effect probably benign
Transcript: ENSMUST00000145016
SMART Domains Protein: ENSMUSP00000114395
Gene: ENSMUSG00000054814

DomainStartEndE-ValueType
Pfam:UCH 27 122 4.4e-30 PFAM
Pfam:UCH_1 28 122 3.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150009
Predicted Effect probably benign
Transcript: ENSMUST00000152408
AA Change: M43K

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000144284
Gene: ENSMUSG00000054814
AA Change: M43K

DomainStartEndE-ValueType
Pfam:UCH 1 132 1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202793
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP46 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced depression-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,435 V106D probably damaging Het
9530053A07Rik A T 7: 28,155,489 I1847F probably damaging Het
Aadacl2 C T 3: 60,025,063 T333I probably damaging Het
Acacb C T 5: 114,195,737 R574C probably damaging Het
Actr10 T C 12: 70,954,656 probably benign Het
Ankdd1a T A 9: 65,504,190 probably null Het
Anks4b C T 7: 120,182,423 Q226* probably null Het
AW146154 C A 7: 41,481,377 G105V probably benign Het
Ccdc129 C A 6: 55,978,395 P996Q probably damaging Het
Cdh4 T A 2: 179,860,226 N326K probably damaging Het
Cnbd1 T C 4: 18,860,517 T410A possibly damaging Het
Cndp2 A T 18: 84,672,076 M247K probably damaging Het
Crx G A 7: 15,868,337 R139C probably damaging Het
Ctrc A G 4: 141,843,726 Y68H probably damaging Het
Ddx4 T C 13: 112,621,245 D326G probably damaging Het
Edem1 C T 6: 108,854,329 R584C possibly damaging Het
Emcn A G 3: 137,379,877 T79A probably benign Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Fbrsl1 C T 5: 110,378,441 G437R probably damaging Het
Fbxo7 A C 10: 86,033,285 Q201P probably benign Het
Fbxo9 T C 9: 78,101,656 M12V possibly damaging Het
Flii A G 11: 60,718,862 S640P probably benign Het
Fsip2 A T 2: 82,981,863 N2842I possibly damaging Het
Fst G T 13: 114,455,705 Q159K probably damaging Het
Fuom A T 7: 140,100,112 *109R probably null Het
Gm9573 T C 17: 35,622,503 probably benign Het
Gm9992 A T 17: 7,369,788 C334S probably benign Het
Hhipl2 A G 1: 183,433,146 D377G probably damaging Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Ighm A G 12: 113,418,981 probably benign Het
Ighv1-85 T A 12: 116,000,227 Y51F probably benign Het
Ighv2-3 A T 12: 113,611,213 D107E probably benign Het
Ighv2-6-8 T A 12: 113,796,567 M1L probably benign Het
Ipo5 T C 14: 120,926,271 V247A probably benign Het
Itga9 T C 9: 118,843,661 F154L possibly damaging Het
Knl1 T A 2: 119,068,348 C177S possibly damaging Het
Lrrc17 G A 5: 21,575,158 G377S probably damaging Het
Marveld3 A T 8: 109,948,617 I189K probably benign Het
Msantd2 G A 9: 37,517,259 G185R probably damaging Het
Mtcl1 G A 17: 66,384,359 probably benign Het
Mycbpap A T 11: 94,507,746 probably null Het
Nbeal1 A G 1: 60,277,194 D1852G probably benign Het
Ndc80 A T 17: 71,500,281 V560D probably benign Het
Olfr1505 T C 19: 13,919,047 V9A probably benign Het
Olfr2 A T 7: 107,001,079 S260R probably damaging Het
Olfr330 A C 11: 58,529,884 V34G probably benign Het
Olfr384 T A 11: 73,603,204 V208E possibly damaging Het
Olfr679 A T 7: 105,086,358 D214V probably damaging Het
Pcdhga4 A T 18: 37,686,598 Y400F probably damaging Het
Pkd2 A G 5: 104,486,649 silent Het
Plxna4 T A 6: 32,206,230 I913F probably damaging Het
Psmc1 T C 12: 100,120,140 probably null Het
Robo2 G A 16: 73,898,965 T1430I probably benign Het
Safb2 G A 17: 56,575,647 R329C probably damaging Het
Sept14 T C 5: 129,697,862 H83R probably damaging Het
Slc16a10 A G 10: 40,076,788 F237L probably benign Het
Slc37a1 A T 17: 31,340,262 T439S probably damaging Het
Slc6a6 T C 6: 91,735,189 F233S probably damaging Het
Smyd3 A T 1: 179,410,459 D114E probably benign Het
Sned1 T C 1: 93,271,602 I468T probably benign Het
Speer4a T A 5: 26,036,738 N130I probably damaging Het
Tdrd7 T C 4: 46,029,757 V1030A probably benign Het
Trip12 A T 1: 84,749,344 D1135E probably damaging Het
Tsga10 T A 1: 37,761,517 D542V probably damaging Het
Ubqlnl G A 7: 104,149,697 Q198* probably null Het
Vmn1r175 A T 7: 23,809,106 I32N possibly damaging Het
Vmn1r29 C T 6: 58,308,123 T276I probably benign Het
Vmn1r81 A T 7: 12,260,107 D191E probably damaging Het
Zbtb5 C A 4: 44,995,052 V111F probably damaging Het
Zfp12 C T 5: 143,244,485 P189L possibly damaging Het
Zfp729b A G 13: 67,591,021 F1042L probably benign Het
Other mutations in Usp46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Usp46 APN 5 74002686 missense probably null 0.03
IGL00401:Usp46 APN 5 74003171 missense probably damaging 1.00
IGL00949:Usp46 APN 5 74003242 missense possibly damaging 0.67
IGL02108:Usp46 APN 5 74029206 missense probably damaging 1.00
IGL02325:Usp46 APN 5 74037028 splice site probably null
IGL02383:Usp46 APN 5 74029353 missense probably benign 0.22
IGL02400:Usp46 APN 5 74037052 missense probably benign 0.00
IGL02833:Usp46 APN 5 74016682 missense probably benign 0.01
R0091:Usp46 UTSW 5 74003257 missense probably benign 0.25
R1186:Usp46 UTSW 5 74002122 missense probably benign 0.01
R1714:Usp46 UTSW 5 74003167 missense probably benign 0.35
R4023:Usp46 UTSW 5 74032475 missense probably damaging 1.00
R4051:Usp46 UTSW 5 74002755 missense probably benign 0.01
R4239:Usp46 UTSW 5 74032267 unclassified probably benign
R4240:Usp46 UTSW 5 74032267 unclassified probably benign
R5907:Usp46 UTSW 5 74037085 missense probably benign 0.05
R6442:Usp46 UTSW 5 74016716 missense probably benign 0.01
R6770:Usp46 UTSW 5 74032354 missense probably benign 0.00
R6856:Usp46 UTSW 5 74028934 unclassified probably benign
R7080:Usp46 UTSW 5 74016683 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GGATAGTCCACACGTACTGAAAAC -3'
(R):5'- CGTCTGTTTGCTCTTGAAGACG -3'

Sequencing Primer
(F):5'- GTAAGCACGAGATATCTCAATACAC -3'
(R):5'- TTGCTCTTGAAGACGCAGAG -3'
Posted On2016-10-24