Incidental Mutation 'R5542:Crx'
ID436029
Institutional Source Beutler Lab
Gene Symbol Crx
Ensembl Gene ENSMUSG00000041578
Gene Namecone-rod homeobox
SynonymsCrx1
MMRRC Submission 043100-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R5542 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location15865947-15879968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 15868337 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 139 (R139C)
Ref Sequence ENSEMBL: ENSMUSP00000134400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044434] [ENSMUST00000132563] [ENSMUST00000172758] [ENSMUST00000174318]
Predicted Effect probably damaging
Transcript: ENSMUST00000044434
AA Change: R115C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043436
Gene: ENSMUSG00000041578
AA Change: R115C

DomainStartEndE-ValueType
HOX 39 101 2.39e-24 SMART
low complexity region 139 153 N/A INTRINSIC
Pfam:TF_Otx 164 250 1.1e-15 PFAM
internal_repeat_1 260 278 1.41e-5 PROSPERO
internal_repeat_1 279 296 1.41e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000132563
AA Change: R115C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133833
Gene: ENSMUSG00000041578
AA Change: R115C

DomainStartEndE-ValueType
HOX 39 101 2.39e-24 SMART
low complexity region 139 153 N/A INTRINSIC
low complexity region 196 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172758
SMART Domains Protein: ENSMUSP00000134463
Gene: ENSMUSG00000041578

DomainStartEndE-ValueType
HOX 39 74 6.07e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174318
AA Change: R139C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134400
Gene: ENSMUSG00000041578
AA Change: R139C

DomainStartEndE-ValueType
HOX 39 101 2.39e-24 SMART
low complexity region 139 153 N/A INTRINSIC
Pfam:TF_Otx 164 250 1.1e-15 PFAM
internal_repeat_1 260 278 1.41e-5 PROSPERO
internal_repeat_1 279 296 1.41e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174358
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a photoreceptor-specific transcription factor which plays a role in the differentiation of photoreceptor cells. This homeodomain protein is necessary for the maintenance of normal cone and rod function. Mutations in this gene are associated with photoreceptor degeneration, Leber congenital amaurosis type III and the autosomal dominant cone-rod dystrophy 2. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a lack of photoreceptor outer segments and rod and cone activity, reduced expression of several photoreceptor- and pineal-specific genes, and altered circadian behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,435 V106D probably damaging Het
9530053A07Rik A T 7: 28,155,489 I1847F probably damaging Het
Aadacl2 C T 3: 60,025,063 T333I probably damaging Het
Acacb C T 5: 114,195,737 R574C probably damaging Het
Actr10 T C 12: 70,954,656 probably benign Het
Ankdd1a T A 9: 65,504,190 probably null Het
Anks4b C T 7: 120,182,423 Q226* probably null Het
AW146154 C A 7: 41,481,377 G105V probably benign Het
Ccdc129 C A 6: 55,978,395 P996Q probably damaging Het
Cdh4 T A 2: 179,860,226 N326K probably damaging Het
Cnbd1 T C 4: 18,860,517 T410A possibly damaging Het
Cndp2 A T 18: 84,672,076 M247K probably damaging Het
Ctrc A G 4: 141,843,726 Y68H probably damaging Het
Ddx4 T C 13: 112,621,245 D326G probably damaging Het
Edem1 C T 6: 108,854,329 R584C possibly damaging Het
Emcn A G 3: 137,379,877 T79A probably benign Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Fbrsl1 C T 5: 110,378,441 G437R probably damaging Het
Fbxo7 A C 10: 86,033,285 Q201P probably benign Het
Fbxo9 T C 9: 78,101,656 M12V possibly damaging Het
Flii A G 11: 60,718,862 S640P probably benign Het
Fsip2 A T 2: 82,981,863 N2842I possibly damaging Het
Fst G T 13: 114,455,705 Q159K probably damaging Het
Fuom A T 7: 140,100,112 *109R probably null Het
Gm9573 T C 17: 35,622,503 probably benign Het
Gm9992 A T 17: 7,369,788 C334S probably benign Het
Hhipl2 A G 1: 183,433,146 D377G probably damaging Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Ighm A G 12: 113,418,981 probably benign Het
Ighv1-85 T A 12: 116,000,227 Y51F probably benign Het
Ighv2-3 A T 12: 113,611,213 D107E probably benign Het
Ighv2-6-8 T A 12: 113,796,567 M1L probably benign Het
Ipo5 T C 14: 120,926,271 V247A probably benign Het
Itga9 T C 9: 118,843,661 F154L possibly damaging Het
Knl1 T A 2: 119,068,348 C177S possibly damaging Het
Lrrc17 G A 5: 21,575,158 G377S probably damaging Het
Marveld3 A T 8: 109,948,617 I189K probably benign Het
Msantd2 G A 9: 37,517,259 G185R probably damaging Het
Mtcl1 G A 17: 66,384,359 probably benign Het
Mycbpap A T 11: 94,507,746 probably null Het
Nbeal1 A G 1: 60,277,194 D1852G probably benign Het
Ndc80 A T 17: 71,500,281 V560D probably benign Het
Olfr1505 T C 19: 13,919,047 V9A probably benign Het
Olfr2 A T 7: 107,001,079 S260R probably damaging Het
Olfr330 A C 11: 58,529,884 V34G probably benign Het
Olfr384 T A 11: 73,603,204 V208E possibly damaging Het
Olfr679 A T 7: 105,086,358 D214V probably damaging Het
Pcdhga4 A T 18: 37,686,598 Y400F probably damaging Het
Pkd2 A G 5: 104,486,649 silent Het
Plxna4 T A 6: 32,206,230 I913F probably damaging Het
Psmc1 T C 12: 100,120,140 probably null Het
Robo2 G A 16: 73,898,965 T1430I probably benign Het
Safb2 G A 17: 56,575,647 R329C probably damaging Het
Sept14 T C 5: 129,697,862 H83R probably damaging Het
Slc16a10 A G 10: 40,076,788 F237L probably benign Het
Slc37a1 A T 17: 31,340,262 T439S probably damaging Het
Slc6a6 T C 6: 91,735,189 F233S probably damaging Het
Smyd3 A T 1: 179,410,459 D114E probably benign Het
Sned1 T C 1: 93,271,602 I468T probably benign Het
Speer4a T A 5: 26,036,738 N130I probably damaging Het
Tdrd7 T C 4: 46,029,757 V1030A probably benign Het
Trip12 A T 1: 84,749,344 D1135E probably damaging Het
Tsga10 T A 1: 37,761,517 D542V probably damaging Het
Ubqlnl G A 7: 104,149,697 Q198* probably null Het
Usp46 A T 5: 74,029,241 M43K probably benign Het
Vmn1r175 A T 7: 23,809,106 I32N possibly damaging Het
Vmn1r29 C T 6: 58,308,123 T276I probably benign Het
Vmn1r81 A T 7: 12,260,107 D191E probably damaging Het
Zbtb5 C A 4: 44,995,052 V111F probably damaging Het
Zfp12 C T 5: 143,244,485 P189L possibly damaging Het
Zfp729b A G 13: 67,591,021 F1042L probably benign Het
Other mutations in Crx
AlleleSourceChrCoordTypePredicted EffectPPH Score
Typhlotic UTSW 7 15868107 nonsense probably null
R0437:Crx UTSW 7 15871146 nonsense probably null
R0729:Crx UTSW 7 15871133 splice site probably benign
R1601:Crx UTSW 7 15867811 unclassified probably null
R1898:Crx UTSW 7 15868223 missense probably damaging 1.00
R1933:Crx UTSW 7 15868376 nonsense probably null
R1988:Crx UTSW 7 15869347 missense possibly damaging 0.95
R5272:Crx UTSW 7 15868285 missense probably damaging 0.99
R5326:Crx UTSW 7 15868337 missense probably damaging 1.00
R6134:Crx UTSW 7 15868107 nonsense probably null
R7313:Crx UTSW 7 15867932 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGGCATAAGGGGCTGAG -3'
(R):5'- GTGTGGGTCTTACCATCAGC -3'

Sequencing Primer
(F):5'- ACTAGGCCGGCTCTCTG -3'
(R):5'- GGGTCTTACCATCAGCTTTGTCTG -3'
Posted On2016-10-24