Incidental Mutation 'R5542:Ddx4'
ID436058
Institutional Source Beutler Lab
Gene Symbol Ddx4
Ensembl Gene ENSMUSG00000021758
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 4
SynonymsMvh, VASA, mvh / m'vasa
MMRRC Submission 043100-MU
Accession Numbers

Genbank: NM_001145885, NM_010029

Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R5542 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location112598333-112652475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112621245 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 326 (D326G)
Ref Sequence ENSEMBL: ENSMUSP00000096769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075748] [ENSMUST00000099166]
Predicted Effect probably damaging
Transcript: ENSMUST00000075748
AA Change: D300G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075157
Gene: ENSMUSG00000021758
AA Change: D300G

DomainStartEndE-ValueType
Blast:DEXDc 22 165 8e-14 BLAST
low complexity region 175 183 N/A INTRINSIC
low complexity region 221 229 N/A INTRINSIC
DEXDc 280 491 9.38e-59 SMART
HELICc 527 608 1.18e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099166
AA Change: D326G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096769
Gene: ENSMUSG00000021758
AA Change: D326G

DomainStartEndE-ValueType
Blast:DEXDc 41 191 7e-25 BLAST
low complexity region 201 209 N/A INTRINSIC
low complexity region 247 255 N/A INTRINSIC
DEXDc 306 517 9.38e-59 SMART
HELICc 553 634 1.18e-32 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a homolog of VASA proteins in Drosophila and several other species. The gene is specifically expressed in the germ cell lineage in both sexes and functions in germ cell development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Spermatogenesis is blocked in homozygous mutant mice, resulting in male infertility. Female mutant mice are fertile and do not exhibit any obvious reproductive defects. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(3) Gene trapped(2)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,435 V106D probably damaging Het
9530053A07Rik A T 7: 28,155,489 I1847F probably damaging Het
Aadacl2 C T 3: 60,025,063 T333I probably damaging Het
Acacb C T 5: 114,195,737 R574C probably damaging Het
Actr10 T C 12: 70,954,656 probably benign Het
Ankdd1a T A 9: 65,504,190 probably null Het
Anks4b C T 7: 120,182,423 Q226* probably null Het
AW146154 C A 7: 41,481,377 G105V probably benign Het
Ccdc129 C A 6: 55,978,395 P996Q probably damaging Het
Cdh4 T A 2: 179,860,226 N326K probably damaging Het
Cnbd1 T C 4: 18,860,517 T410A possibly damaging Het
Cndp2 A T 18: 84,672,076 M247K probably damaging Het
Crx G A 7: 15,868,337 R139C probably damaging Het
Ctrc A G 4: 141,843,726 Y68H probably damaging Het
Edem1 C T 6: 108,854,329 R584C possibly damaging Het
Emcn A G 3: 137,379,877 T79A probably benign Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Fbrsl1 C T 5: 110,378,441 G437R probably damaging Het
Fbxo7 A C 10: 86,033,285 Q201P probably benign Het
Fbxo9 T C 9: 78,101,656 M12V possibly damaging Het
Flii A G 11: 60,718,862 S640P probably benign Het
Fsip2 A T 2: 82,981,863 N2842I possibly damaging Het
Fst G T 13: 114,455,705 Q159K probably damaging Het
Fuom A T 7: 140,100,112 *109R probably null Het
Gm9573 T C 17: 35,622,503 probably benign Het
Gm9992 A T 17: 7,369,788 C334S probably benign Het
Hhipl2 A G 1: 183,433,146 D377G probably damaging Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Ighm A G 12: 113,418,981 probably benign Het
Ighv1-85 T A 12: 116,000,227 Y51F probably benign Het
Ighv2-3 A T 12: 113,611,213 D107E probably benign Het
Ighv2-6-8 T A 12: 113,796,567 M1L probably benign Het
Ipo5 T C 14: 120,926,271 V247A probably benign Het
Itga9 T C 9: 118,843,661 F154L possibly damaging Het
Knl1 T A 2: 119,068,348 C177S possibly damaging Het
Lrrc17 G A 5: 21,575,158 G377S probably damaging Het
Marveld3 A T 8: 109,948,617 I189K probably benign Het
Msantd2 G A 9: 37,517,259 G185R probably damaging Het
Mtcl1 G A 17: 66,384,359 probably benign Het
Mycbpap A T 11: 94,507,746 probably null Het
Nbeal1 A G 1: 60,277,194 D1852G probably benign Het
Ndc80 A T 17: 71,500,281 V560D probably benign Het
Olfr1505 T C 19: 13,919,047 V9A probably benign Het
Olfr2 A T 7: 107,001,079 S260R probably damaging Het
Olfr330 A C 11: 58,529,884 V34G probably benign Het
Olfr384 T A 11: 73,603,204 V208E possibly damaging Het
Olfr679 A T 7: 105,086,358 D214V probably damaging Het
Pcdhga4 A T 18: 37,686,598 Y400F probably damaging Het
Pkd2 A G 5: 104,486,649 silent Het
Plxna4 T A 6: 32,206,230 I913F probably damaging Het
Psmc1 T C 12: 100,120,140 probably null Het
Robo2 G A 16: 73,898,965 T1430I probably benign Het
Safb2 G A 17: 56,575,647 R329C probably damaging Het
Sept14 T C 5: 129,697,862 H83R probably damaging Het
Slc16a10 A G 10: 40,076,788 F237L probably benign Het
Slc37a1 A T 17: 31,340,262 T439S probably damaging Het
Slc6a6 T C 6: 91,735,189 F233S probably damaging Het
Smyd3 A T 1: 179,410,459 D114E probably benign Het
Sned1 T C 1: 93,271,602 I468T probably benign Het
Speer4a T A 5: 26,036,738 N130I probably damaging Het
Tdrd7 T C 4: 46,029,757 V1030A probably benign Het
Trip12 A T 1: 84,749,344 D1135E probably damaging Het
Tsga10 T A 1: 37,761,517 D542V probably damaging Het
Ubqlnl G A 7: 104,149,697 Q198* probably null Het
Usp46 A T 5: 74,029,241 M43K probably benign Het
Vmn1r175 A T 7: 23,809,106 I32N possibly damaging Het
Vmn1r29 C T 6: 58,308,123 T276I probably benign Het
Vmn1r81 A T 7: 12,260,107 D191E probably damaging Het
Zbtb5 C A 4: 44,995,052 V111F probably damaging Het
Zfp12 C T 5: 143,244,485 P189L possibly damaging Het
Zfp729b A G 13: 67,591,021 F1042L probably benign Het
Other mutations in Ddx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02030:Ddx4 APN 13 112624777 splice site probably benign
IGL02682:Ddx4 APN 13 112622186 missense probably benign 0.04
IGL02729:Ddx4 APN 13 112651412 utr 5 prime probably benign
H8930:Ddx4 UTSW 13 112613833 splice site probably null
R0518:Ddx4 UTSW 13 112624779 critical splice donor site probably null
R0521:Ddx4 UTSW 13 112624779 critical splice donor site probably null
R1527:Ddx4 UTSW 13 112622239 missense possibly damaging 0.95
R1548:Ddx4 UTSW 13 112599997 missense probably damaging 1.00
R1773:Ddx4 UTSW 13 112599902 missense probably benign
R1886:Ddx4 UTSW 13 112622665 missense probably damaging 1.00
R1969:Ddx4 UTSW 13 112600013 missense probably damaging 0.99
R1969:Ddx4 UTSW 13 112620742 missense probably damaging 0.99
R1970:Ddx4 UTSW 13 112600013 missense probably damaging 0.99
R1971:Ddx4 UTSW 13 112600013 missense probably damaging 0.99
R2265:Ddx4 UTSW 13 112621276 missense probably benign 0.08
R2280:Ddx4 UTSW 13 112620656 missense probably benign 0.03
R2846:Ddx4 UTSW 13 112604612 missense probably damaging 0.99
R2906:Ddx4 UTSW 13 112620777 splice site probably benign
R2980:Ddx4 UTSW 13 112612085 missense probably damaging 1.00
R3732:Ddx4 UTSW 13 112611982 missense possibly damaging 0.56
R4085:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4088:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4089:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4090:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4600:Ddx4 UTSW 13 112612060 missense probably damaging 1.00
R4610:Ddx4 UTSW 13 112612060 missense probably damaging 1.00
R4669:Ddx4 UTSW 13 112622244 missense probably damaging 1.00
R4700:Ddx4 UTSW 13 112613735 missense probably damaging 1.00
R4782:Ddx4 UTSW 13 112613696 critical splice donor site probably null
R4782:Ddx4 UTSW 13 112651360 missense probably benign 0.10
R5326:Ddx4 UTSW 13 112621245 missense probably damaging 1.00
R6111:Ddx4 UTSW 13 112621232 nonsense probably null
R6253:Ddx4 UTSW 13 112636022 nonsense probably null
R6253:Ddx4 UTSW 13 112636023 missense probably benign 0.00
R6286:Ddx4 UTSW 13 112613735 missense probably damaging 1.00
R6518:Ddx4 UTSW 13 112604547 missense probably benign
R6645:Ddx4 UTSW 13 112641174 missense possibly damaging 0.70
R7017:Ddx4 UTSW 13 112601488 missense probably damaging 1.00
R7155:Ddx4 UTSW 13 112613785 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACCGTGAATCCTAATGATGGC -3'
(R):5'- TAAGTTTAAGGTTCCCTCCAACAGAG -3'

Sequencing Primer
(F):5'- TGGCTCAGATTATCTACAGATCTTC -3'
(R):5'- ATGTTTATGGAATGGTGAGCAC -3'
Posted On2016-10-24