Incidental Mutation 'R5542:Gm9992'
ID436064
Institutional Source Beutler Lab
Gene Symbol Gm9992
Ensembl Gene ENSMUSG00000056133
Gene Namepredicted gene 9992
SynonymsUnc93a
MMRRC Submission 043100-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R5542 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location7362815-7385464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7369788 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 334 (C334S)
Ref Sequence ENSEMBL: ENSMUSP00000064469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070059] [ENSMUST00000231397] [ENSMUST00000231922]
Predicted Effect probably benign
Transcript: ENSMUST00000070059
AA Change: C334S

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000064469
Gene: ENSMUSG00000056133
AA Change: C334S

DomainStartEndE-ValueType
Pfam:UNC-93 11 168 2.7e-16 PFAM
transmembrane domain 199 221 N/A INTRINSIC
low complexity region 235 241 N/A INTRINSIC
transmembrane domain 258 275 N/A INTRINSIC
transmembrane domain 290 312 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178099
Predicted Effect probably benign
Transcript: ENSMUST00000231397
AA Change: C114S

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000231922
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,435 V106D probably damaging Het
9530053A07Rik A T 7: 28,155,489 I1847F probably damaging Het
Aadacl2 C T 3: 60,025,063 T333I probably damaging Het
Acacb C T 5: 114,195,737 R574C probably damaging Het
Actr10 T C 12: 70,954,656 probably benign Het
Ankdd1a T A 9: 65,504,190 probably null Het
Anks4b C T 7: 120,182,423 Q226* probably null Het
AW146154 C A 7: 41,481,377 G105V probably benign Het
Ccdc129 C A 6: 55,978,395 P996Q probably damaging Het
Cdh4 T A 2: 179,860,226 N326K probably damaging Het
Cnbd1 T C 4: 18,860,517 T410A possibly damaging Het
Cndp2 A T 18: 84,672,076 M247K probably damaging Het
Crx G A 7: 15,868,337 R139C probably damaging Het
Ctrc A G 4: 141,843,726 Y68H probably damaging Het
Ddx4 T C 13: 112,621,245 D326G probably damaging Het
Edem1 C T 6: 108,854,329 R584C possibly damaging Het
Emcn A G 3: 137,379,877 T79A probably benign Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Fbrsl1 C T 5: 110,378,441 G437R probably damaging Het
Fbxo7 A C 10: 86,033,285 Q201P probably benign Het
Fbxo9 T C 9: 78,101,656 M12V possibly damaging Het
Flii A G 11: 60,718,862 S640P probably benign Het
Fsip2 A T 2: 82,981,863 N2842I possibly damaging Het
Fst G T 13: 114,455,705 Q159K probably damaging Het
Fuom A T 7: 140,100,112 *109R probably null Het
Gm9573 T C 17: 35,622,503 probably benign Het
Hhipl2 A G 1: 183,433,146 D377G probably damaging Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Ighm A G 12: 113,418,981 probably benign Het
Ighv1-85 T A 12: 116,000,227 Y51F probably benign Het
Ighv2-3 A T 12: 113,611,213 D107E probably benign Het
Ighv2-6-8 T A 12: 113,796,567 M1L probably benign Het
Ipo5 T C 14: 120,926,271 V247A probably benign Het
Itga9 T C 9: 118,843,661 F154L possibly damaging Het
Knl1 T A 2: 119,068,348 C177S possibly damaging Het
Lrrc17 G A 5: 21,575,158 G377S probably damaging Het
Marveld3 A T 8: 109,948,617 I189K probably benign Het
Msantd2 G A 9: 37,517,259 G185R probably damaging Het
Mtcl1 G A 17: 66,384,359 probably benign Het
Mycbpap A T 11: 94,507,746 probably null Het
Nbeal1 A G 1: 60,277,194 D1852G probably benign Het
Ndc80 A T 17: 71,500,281 V560D probably benign Het
Olfr1505 T C 19: 13,919,047 V9A probably benign Het
Olfr2 A T 7: 107,001,079 S260R probably damaging Het
Olfr330 A C 11: 58,529,884 V34G probably benign Het
Olfr384 T A 11: 73,603,204 V208E possibly damaging Het
Olfr679 A T 7: 105,086,358 D214V probably damaging Het
Pcdhga4 A T 18: 37,686,598 Y400F probably damaging Het
Pkd2 A G 5: 104,486,649 silent Het
Plxna4 T A 6: 32,206,230 I913F probably damaging Het
Psmc1 T C 12: 100,120,140 probably null Het
Robo2 G A 16: 73,898,965 T1430I probably benign Het
Safb2 G A 17: 56,575,647 R329C probably damaging Het
Sept14 T C 5: 129,697,862 H83R probably damaging Het
Slc16a10 A G 10: 40,076,788 F237L probably benign Het
Slc37a1 A T 17: 31,340,262 T439S probably damaging Het
Slc6a6 T C 6: 91,735,189 F233S probably damaging Het
Smyd3 A T 1: 179,410,459 D114E probably benign Het
Sned1 T C 1: 93,271,602 I468T probably benign Het
Speer4a T A 5: 26,036,738 N130I probably damaging Het
Tdrd7 T C 4: 46,029,757 V1030A probably benign Het
Trip12 A T 1: 84,749,344 D1135E probably damaging Het
Tsga10 T A 1: 37,761,517 D542V probably damaging Het
Ubqlnl G A 7: 104,149,697 Q198* probably null Het
Usp46 A T 5: 74,029,241 M43K probably benign Het
Vmn1r175 A T 7: 23,809,106 I32N possibly damaging Het
Vmn1r29 C T 6: 58,308,123 T276I probably benign Het
Vmn1r81 A T 7: 12,260,107 D191E probably damaging Het
Zbtb5 C A 4: 44,995,052 V111F probably damaging Het
Zfp12 C T 5: 143,244,485 P189L possibly damaging Het
Zfp729b A G 13: 67,591,021 F1042L probably benign Het
Other mutations in Gm9992
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Gm9992 APN 17 7369739 missense probably damaging 1.00
IGL01609:Gm9992 APN 17 7369739 missense probably damaging 0.96
R0893:Gm9992 UTSW 17 7374527 missense probably damaging 0.98
R5271:Gm9992 UTSW 17 7369682 missense possibly damaging 0.82
R5326:Gm9992 UTSW 17 7369788 missense probably benign 0.35
R5567:Gm9992 UTSW 17 7363803 missense probably benign 0.04
R5750:Gm9992 UTSW 17 7369731 missense probably benign 0.11
R6465:Gm9992 UTSW 17 7374443 missense probably damaging 1.00
R6714:Gm9992 UTSW 17 7376538 missense probably benign 0.05
R7130:Gm9992 UTSW 17 7370425 missense probably benign 0.16
R7142:Gm9992 UTSW 17 7376622 missense probably damaging 0.97
R7222:Gm9992 UTSW 17 7376467 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCCTCAAGGACAGCTGAC -3'
(R):5'- TGGTCCTCACAGCATAGAGG -3'

Sequencing Primer
(F):5'- CTGAGGGAGATGGAGGCCTTG -3'
(R):5'- GCCTCCCTCAGAGTCAGTCATAC -3'
Posted On2016-10-24