Incidental Mutation 'R5545:Tbr1'
ID436177
Institutional Source Beutler Lab
Gene Symbol Tbr1
Ensembl Gene ENSMUSG00000035033
Gene NameT-box brain gene 1
Synonyms
MMRRC Submission 043103-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5545 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location61802930-61814114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 61807376 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 93 (V93G)
Ref Sequence ENSEMBL: ENSMUSP00000099798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048934] [ENSMUST00000102737]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048934
AA Change: V356G

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000046787
Gene: ENSMUSG00000035033
AA Change: V356G

DomainStartEndE-ValueType
low complexity region 108 122 N/A INTRINSIC
TBOX 203 398 1.6e-125 SMART
Pfam:T-box_assoc 418 679 9.6e-93 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102737
AA Change: V93G

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099798
Gene: ENSMUSG00000035033
AA Change: V93G

DomainStartEndE-ValueType
TBOX 1 135 5.05e-41 SMART
low complexity region 184 193 N/A INTRINSIC
low complexity region 306 315 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
low complexity region 355 365 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136867
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of numerous developmental processes. In mouse, the ortholog of this gene is expressed in the cerebral cortex, hippocampus, amygdala and olfactory bulb and is thought to play an important role in neuronal migration and axonal projection. In mouse, the C-terminal region of this protein was found to be necessary and sufficient for association with the guanylate kinase domain of calcium/calmodulin-dependent serine protein kinase. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a targeted null allele fail to feed and die on the second postnatal day displaying disrupted forebrain morphology and a hypoplastic olfactory bulb that lacks normal mitral and tufted cells and shows a striking reduction in mature olfactory bulb projection neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T C 3: 145,939,098 probably null Het
Acot5 G A 12: 84,069,606 R47Q possibly damaging Het
Akr1c19 A T 13: 4,242,595 Y205F probably benign Het
Cdh6 T C 15: 13,041,149 Y564C probably damaging Het
Cngb1 A G 8: 95,252,173 S551P probably damaging Het
Cyp20a1 T C 1: 60,376,082 I289T possibly damaging Het
Gm17677 A G 9: 35,741,644 I61V probably benign Het
Herc6 A T 6: 57,658,007 probably null Het
Ifnar2 G A 16: 91,385,025 probably null Het
Kcnd2 A G 6: 21,217,019 T241A probably damaging Het
Nfatc2ip T A 7: 126,390,470 E247D possibly damaging Het
Olfr1394 G A 11: 49,160,626 C204Y probably damaging Het
Olfr267 T G 4: 58,785,585 I46L probably benign Het
Plekhg2 T C 7: 28,362,461 E638G probably damaging Het
Plin1 T C 7: 79,726,509 T160A probably benign Het
Prox1 T A 1: 190,147,142 N613I probably damaging Het
Ptpn13 A G 5: 103,561,964 S1498G probably damaging Het
Ralbp1 C T 17: 65,850,104 R598Q possibly damaging Het
Robo2 A C 16: 73,961,747 V712G probably damaging Het
Rsl1d1 A G 16: 11,199,650 F151L probably damaging Het
Scrn3 T A 2: 73,335,781 I386N possibly damaging Het
Sorl1 T A 9: 41,991,625 Y1591F probably benign Het
Tmem229b A G 12: 78,964,809 I116T probably damaging Het
Ttn T C 2: 76,764,376 Q12115R possibly damaging Het
Ube3a C T 7: 59,272,024 T48M probably damaging Het
Vnn3 A G 10: 23,867,094 I401V probably benign Het
Wdr90 C T 17: 25,845,856 R1744H probably damaging Het
Zc3h7a T C 16: 11,148,451 D604G possibly damaging Het
Other mutations in Tbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Tbr1 APN 2 61805281 missense probably benign 0.14
IGL01309:Tbr1 APN 2 61806067 missense possibly damaging 0.92
IGL02161:Tbr1 APN 2 61805239 nonsense probably null
IGL02256:Tbr1 APN 2 61804874 missense probably damaging 0.99
IGL02336:Tbr1 APN 2 61804992 missense possibly damaging 0.93
IGL02526:Tbr1 APN 2 61811698 missense probably benign 0.00
FR4340:Tbr1 UTSW 2 61806347 intron probably benign
R0594:Tbr1 UTSW 2 61811620 missense possibly damaging 0.49
R0847:Tbr1 UTSW 2 61805029 missense probably benign 0.00
R1101:Tbr1 UTSW 2 61804739 missense probably benign 0.00
R1247:Tbr1 UTSW 2 61811618 missense possibly damaging 0.78
R1944:Tbr1 UTSW 2 61812256 missense probably damaging 1.00
R3080:Tbr1 UTSW 2 61807291 nonsense probably null
R4110:Tbr1 UTSW 2 61811732 missense probably benign 0.18
R4111:Tbr1 UTSW 2 61811732 missense probably benign 0.18
R4440:Tbr1 UTSW 2 61804838 missense possibly damaging 0.92
R4790:Tbr1 UTSW 2 61811588 missense probably benign 0.04
R4979:Tbr1 UTSW 2 61805249 unclassified probably null
R5054:Tbr1 UTSW 2 61806002 missense possibly damaging 0.83
R5283:Tbr1 UTSW 2 61804900 missense probably benign 0.00
R6178:Tbr1 UTSW 2 61804815 missense possibly damaging 0.91
R6290:Tbr1 UTSW 2 61805050 missense probably benign
R6389:Tbr1 UTSW 2 61806287 start gained probably benign
R6637:Tbr1 UTSW 2 61811630 missense probably benign 0.17
R6983:Tbr1 UTSW 2 61811735 missense probably damaging 1.00
R7021:Tbr1 UTSW 2 61807344 missense probably benign 0.18
R7112:Tbr1 UTSW 2 61811816 missense probably benign 0.02
R7254:Tbr1 UTSW 2 61806042 missense probably damaging 1.00
R7291:Tbr1 UTSW 2 61812256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGGCTTCCAAAGGTACC -3'
(R):5'- TAAACCTTGCTGTAGGGCCAG -3'

Sequencing Primer
(F):5'- AGATGAGTCCCACGGCTAGTC -3'
(R):5'- AGCTGTGGCCTAGGCTAGTC -3'
Posted On2016-10-24