Incidental Mutation 'R0006:Nup188'
ID43618
Institutional Source Beutler Lab
Gene Symbol Nup188
Ensembl Gene ENSMUSG00000052533
Gene Namenucleoporin 188
Synonyms
MMRRC Submission 041980-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R0006 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location30286397-30344266 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30322023 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 553 (V553A)
Ref Sequence ENSEMBL: ENSMUSP00000065836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064447]
Predicted Effect probably benign
Transcript: ENSMUST00000064447
AA Change: V553A

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000065836
Gene: ENSMUSG00000052533
AA Change: V553A

DomainStartEndE-ValueType
Pfam:Nup188 31 941 9.3e-213 PFAM
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1307 1320 N/A INTRINSIC
low complexity region 1330 1360 N/A INTRINSIC
low complexity region 1696 1709 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141035
Meta Mutation Damage Score 0.278 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex (NPC) is found on the nuclear envelope and forms a gateway that regulates the flow of proteins and RNAs between the cytoplasm and nucleoplasm. The NPC is comprised of approximately 30 distinct proteins collectively known as nucleoporins. Nucleoporins are pore-complex-specific glycoproteins which often have cytoplasmically oriented O-linked N-acetylglucosamine residues and numerous repeats of the pentapeptide sequence XFXFG. However, the nucleoporin protein encoded by this gene does not contain the typical FG repeat sequences found in most vertebrate nucleoporins. This nucleoporin is thought to form part of the scaffold for the central channel of the nuclear pore. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,863,935 probably benign Het
Aldh3a1 G A 11: 61,217,101 V324M probably damaging Het
Als2cl T A 9: 110,894,618 L694Q possibly damaging Het
Appl2 A G 10: 83,602,898 F556L probably damaging Het
Atad2b T A 12: 4,942,030 S210T possibly damaging Het
Aurka A G 2: 172,359,753 probably null Het
Boc C T 16: 44,496,449 V444I probably benign Het
Ccdc109b A C 3: 129,933,765 probably benign Het
Cfap61 G A 2: 146,077,312 V655I probably benign Het
Chd8 A G 14: 52,235,293 I351T possibly damaging Het
Chid1 T A 7: 141,496,426 probably benign Het
Cyp3a41a T A 5: 145,704,796 H288L probably benign Het
Dnase2b T A 3: 146,582,489 I284F probably damaging Het
Dock2 A G 11: 34,312,453 probably benign Het
Dst C T 1: 34,228,918 T5325I probably benign Het
Erbb3 A G 10: 128,573,410 probably null Het
Fam129c A G 8: 71,605,044 probably benign Het
Fancl A G 11: 26,469,695 N316S possibly damaging Het
Farsa G T 8: 84,861,305 probably benign Het
Fibcd1 T G 2: 31,838,587 D86A probably damaging Het
Gab1 A T 8: 80,769,730 M617K possibly damaging Het
Gabrd C A 4: 155,388,601 V72L probably damaging Het
Ggh C A 4: 20,054,155 T150K possibly damaging Het
Gm340 A G 19: 41,584,899 T698A probably benign Het
Gnb3 G A 6: 124,835,804 probably benign Het
Hephl1 T A 9: 15,076,764 T683S probably benign Het
Hmcn1 G A 1: 150,808,676 P381L probably damaging Het
Hspa8 T G 9: 40,804,629 N544K probably benign Het
Hspg2 C T 4: 137,519,931 T1155I probably damaging Het
Igdcc4 C T 9: 65,135,100 probably benign Het
Jazf1 A G 6: 52,894,086 probably benign Het
Kntc1 T A 5: 123,789,138 S1219T probably benign Het
L3mbtl1 A T 2: 162,964,569 Y460F possibly damaging Het
Lyrm7 T A 11: 54,848,597 T76S probably benign Het
Map1b C T 13: 99,435,302 V304M probably damaging Het
Muc13 T C 16: 33,803,148 S271P probably damaging Het
Myo16 A G 8: 10,475,988 K843E probably damaging Het
Nav2 A G 7: 49,453,230 E531G possibly damaging Het
Olfr1 A G 11: 73,395,488 F178S probably damaging Het
Olfr1348 A G 7: 6,501,611 I205T possibly damaging Het
Olfr376 A G 11: 73,375,588 M283V possibly damaging Het
Olfr646 A G 7: 104,106,320 I14V probably benign Het
Olfr877 T A 9: 37,855,220 V134D possibly damaging Het
P4ha3 C T 7: 100,318,948 R378* probably null Het
Rap1gds1 G T 3: 138,983,871 probably null Het
Rbfox1 T A 16: 7,330,420 S244R probably benign Het
Rpp40 G A 13: 35,896,735 P339S probably damaging Het
Rsph4a T C 10: 33,909,148 C148R probably damaging Het
Skint5 T C 4: 113,893,862 probably benign Het
Sptbn1 A G 11: 30,123,855 S1405P probably damaging Het
Tex35 T C 1: 157,099,744 K154E possibly damaging Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tle4 A G 19: 14,466,714 probably benign Het
Tnxb T C 17: 34,682,292 S1027P probably benign Het
Tpm3 T A 3: 90,087,661 probably benign Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Uggt2 A T 14: 119,049,663 F640L probably benign Het
Vmn1r20 T G 6: 57,432,305 H205Q probably damaging Het
Wbp2 T C 11: 116,079,788 probably null Het
Xirp1 T C 9: 120,017,454 I788V probably benign Het
Zc3hav1 A G 6: 38,319,702 probably null Het
Zfp687 A G 3: 95,011,456 I335T probably damaging Het
Zfpm1 A G 8: 122,334,488 Y264C probably damaging Het
Other mutations in Nup188
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Nup188 APN 2 30333400 missense probably damaging 0.98
IGL01599:Nup188 APN 2 30327525 missense possibly damaging 0.92
IGL01938:Nup188 APN 2 30329359 missense probably benign
IGL01973:Nup188 APN 2 30339850 missense possibly damaging 0.95
IGL02157:Nup188 APN 2 30329373 nonsense probably null
IGL02221:Nup188 APN 2 30330641 missense possibly damaging 0.75
IGL02277:Nup188 APN 2 30326511 missense possibly damaging 0.95
IGL02335:Nup188 APN 2 30323636 critical splice donor site probably null
IGL02986:Nup188 APN 2 30307633 unclassified probably null
IGL03029:Nup188 APN 2 30322580 splice site probably benign
IGL03194:Nup188 APN 2 30304334 missense possibly damaging 0.95
IGL03370:Nup188 APN 2 30340641 missense possibly damaging 0.52
P0027:Nup188 UTSW 2 30322681 missense probably damaging 0.99
R0360:Nup188 UTSW 2 30326479 missense probably null 0.93
R0373:Nup188 UTSW 2 30330988 missense probably damaging 1.00
R0645:Nup188 UTSW 2 30343466 unclassified probably null
R1411:Nup188 UTSW 2 30343795 missense probably benign 0.01
R1670:Nup188 UTSW 2 30340655 missense probably benign 0.19
R2034:Nup188 UTSW 2 30310085 unclassified probably benign
R2113:Nup188 UTSW 2 30304101 nonsense probably null
R2142:Nup188 UTSW 2 30336706 missense possibly damaging 0.49
R2221:Nup188 UTSW 2 30336924 splice site probably benign
R2567:Nup188 UTSW 2 30341782 missense possibly damaging 0.53
R2964:Nup188 UTSW 2 30325346 missense probably damaging 0.98
R4006:Nup188 UTSW 2 30309878 missense probably damaging 0.99
R4007:Nup188 UTSW 2 30309878 missense probably damaging 0.99
R4079:Nup188 UTSW 2 30309878 missense probably damaging 0.99
R4480:Nup188 UTSW 2 30322129 intron probably benign
R4628:Nup188 UTSW 2 30329346 missense probably damaging 1.00
R4687:Nup188 UTSW 2 30330633 missense probably benign 0.01
R4814:Nup188 UTSW 2 30326511 missense possibly damaging 0.95
R4834:Nup188 UTSW 2 30339584 missense probably damaging 1.00
R5038:Nup188 UTSW 2 30309220 missense probably damaging 0.98
R5056:Nup188 UTSW 2 30304131 missense probably damaging 0.98
R5124:Nup188 UTSW 2 30330935 missense probably damaging 1.00
R5256:Nup188 UTSW 2 30330749 missense probably damaging 1.00
R5284:Nup188 UTSW 2 30330635 missense probably damaging 1.00
R5548:Nup188 UTSW 2 30326493 missense probably damaging 0.99
R5560:Nup188 UTSW 2 30309885 missense probably damaging 0.99
R5668:Nup188 UTSW 2 30336324 missense probably damaging 1.00
R5769:Nup188 UTSW 2 30330735 missense probably benign 0.34
R5773:Nup188 UTSW 2 30322196 missense possibly damaging 0.92
R5774:Nup188 UTSW 2 30301048 missense probably damaging 1.00
R5827:Nup188 UTSW 2 30339847 missense probably damaging 1.00
R5919:Nup188 UTSW 2 30339894 missense probably damaging 1.00
R5923:Nup188 UTSW 2 30304090 missense probably benign
R6185:Nup188 UTSW 2 30341710 missense probably damaging 0.97
R6457:Nup188 UTSW 2 30322187 missense probably damaging 0.98
R6529:Nup188 UTSW 2 30326454 missense possibly damaging 0.95
R7002:Nup188 UTSW 2 30323568 missense probably damaging 0.99
R7195:Nup188 UTSW 2 30341830 critical splice donor site probably null
R7214:Nup188 UTSW 2 30307554 missense possibly damaging 0.71
R7345:Nup188 UTSW 2 30340601 missense probably benign 0.09
T0722:Nup188 UTSW 2 30322681 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGATCACAGGCATTTCTCTTCCATAGG -3'
(R):5'- AACAGTCACTGCTGCAAGCTCC -3'

Sequencing Primer
(F):5'- TCTCTTCCATAGGGGGTCAGAC -3'
(R):5'- ACAAGTCTGTGCTGATGACC -3'
Posted On2013-05-29