Incidental Mutation 'R5545:2410004B18Rik'
List |< first << previous [record 37 of 9592] next >> last >|
ID436180
Institutional Source Beutler Lab
Gene Symbol 2410004B18Rik
Ensembl Gene ENSMUSG00000036873
Gene NameRIKEN cDNA 2410004B18 gene
Synonyms
MMRRC Submission 043103-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R5545 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location145938014-145944829 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 145939098 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029842] [ENSMUST00000039571] [ENSMUST00000134575]
Predicted Effect probably benign
Transcript: ENSMUST00000029842
SMART Domains Protein: ENSMUSP00000029842
Gene: ENSMUSG00000028191

DomainStartEndE-ValueType
Pfam:CARD 18 102 8e-20 PFAM
low complexity region 192 209 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000039571
SMART Domains Protein: ENSMUSP00000045376
Gene: ENSMUSG00000036873

DomainStartEndE-ValueType
Pfam:DUF4660 20 125 2.8e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134575
SMART Domains Protein: ENSMUSP00000119149
Gene: ENSMUSG00000036873

DomainStartEndE-ValueType
Pfam:DUF4660 19 97 2.4e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138876
Predicted Effect probably benign
Transcript: ENSMUST00000152783
SMART Domains Protein: ENSMUSP00000118224
Gene: ENSMUSG00000036873

DomainStartEndE-ValueType
Pfam:DUF4660 1 53 6.3e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000188034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189656
Predicted Effect probably null
Transcript: ENSMUST00000190472
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot5 G A 12: 84,069,606 R47Q possibly damaging Het
Akr1c19 A T 13: 4,242,595 Y205F probably benign Het
Cdh6 T C 15: 13,041,149 Y564C probably damaging Het
Cngb1 A G 8: 95,252,173 S551P probably damaging Het
Cyp20a1 T C 1: 60,376,082 I289T possibly damaging Het
Gm17677 A G 9: 35,741,644 I61V probably benign Het
Herc6 A T 6: 57,658,007 probably null Het
Ifnar2 G A 16: 91,385,025 probably null Het
Kcnd2 A G 6: 21,217,019 T241A probably damaging Het
Nfatc2ip T A 7: 126,390,470 E247D possibly damaging Het
Olfr1394 G A 11: 49,160,626 C204Y probably damaging Het
Olfr267 T G 4: 58,785,585 I46L probably benign Het
Plekhg2 T C 7: 28,362,461 E638G probably damaging Het
Plin1 T C 7: 79,726,509 T160A probably benign Het
Prox1 T A 1: 190,147,142 N613I probably damaging Het
Ptpn13 A G 5: 103,561,964 S1498G probably damaging Het
Ralbp1 C T 17: 65,850,104 R598Q possibly damaging Het
Robo2 A C 16: 73,961,747 V712G probably damaging Het
Rsl1d1 A G 16: 11,199,650 F151L probably damaging Het
Scrn3 T A 2: 73,335,781 I386N possibly damaging Het
Sorl1 T A 9: 41,991,625 Y1591F probably benign Het
Tbr1 T G 2: 61,807,376 V93G possibly damaging Het
Tmem229b A G 12: 78,964,809 I116T probably damaging Het
Ttn T C 2: 76,764,376 Q12115R possibly damaging Het
Ube3a C T 7: 59,272,024 T48M probably damaging Het
Vnn3 A G 10: 23,867,094 I401V probably benign Het
Wdr90 C T 17: 25,845,856 R1744H probably damaging Het
Zc3h7a T C 16: 11,148,451 D604G possibly damaging Het
Other mutations in 2410004B18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0243:2410004B18Rik UTSW 3 145938078 missense probably damaging 1.00
R1960:2410004B18Rik UTSW 3 145938221 missense probably damaging 1.00
R4155:2410004B18Rik UTSW 3 145938263 missense possibly damaging 0.70
R4156:2410004B18Rik UTSW 3 145938263 missense possibly damaging 0.70
R4931:2410004B18Rik UTSW 3 145938120 missense probably benign 0.00
R6958:2410004B18Rik UTSW 3 145943803 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- ATCTGGAAGTCCAACTGCGTG -3'
(R):5'- AGAGACCTCTGAGACTACTTTCAG -3'

Sequencing Primer
(F):5'- GTGCCGCCCCCAGAGAC -3'
(R):5'- TCAGTCCTAGCACTGAGATACTGAG -3'
Posted On2016-10-24