Incidental Mutation 'R5532:Gja8'
ID436210
Institutional Source Beutler Lab
Gene Symbol Gja8
Ensembl Gene ENSMUSG00000049908
Gene Namegap junction protein, alpha 8
SynonymsCx50, Cnx50, alpha 8 connexin, connexin 50, Lop10, Aey5
MMRRC Submission 043090-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5532 (G1)
Quality Score150
Status Not validated
Chromosome3
Chromosomal Location96913566-96926020 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96920332 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 5 (S5G)
Ref Sequence ENSEMBL: ENSMUSP00000049532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062944] [ENSMUST00000199597]
Predicted Effect probably benign
Transcript: ENSMUST00000062944
AA Change: S5G

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049532
Gene: ENSMUSG00000049908
AA Change: S5G

DomainStartEndE-ValueType
CNX 43 76 1.76e-20 SMART
low complexity region 134 147 N/A INTRINSIC
Connexin_CCC 168 234 2.8e-41 SMART
Pfam:Connexin50 267 333 7.3e-35 PFAM
low complexity region 337 355 N/A INTRINSIC
low complexity region 423 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199597
SMART Domains Protein: ENSMUSP00000143542
Gene: ENSMUSG00000057123

DomainStartEndE-ValueType
CNX 43 76 3.47e-19 SMART
Connexin_CCC 163 229 2.45e-37 SMART
Pfam:Connexin40_C 257 358 2.4e-33 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane connexin protein that is necessary for lens growth and maturation of lens fiber cells. The encoded protein is a component of gap junction channels and functions in a calcium and pH-dependent manner. Mutations in this gene have been associated with zonular pulverulent cataracts, nuclear progressive cataracts, and cataract-microcornea syndrome. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous mutants exhibit microphthalmia, with small lenses and nuclear or total cataracts. Heterozygotes may be equally or less affected, depending on the particular mutation and the genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
A2ml1 T A 6: 128,553,330 probably null Het
Adsl C G 15: 80,963,909 P118A probably damaging Het
Ano6 C T 15: 95,962,241 P748L probably damaging Het
Arhgap10 A T 8: 77,420,072 N234K probably benign Het
Arhgap18 T A 10: 26,846,108 I25K possibly damaging Het
AW551984 T C 9: 39,597,185 Y345C probably damaging Het
Ccdc146 A G 5: 21,305,331 V561A probably benign Het
Cenpv G A 11: 62,527,572 T185M probably damaging Het
Fat2 T A 11: 55,262,337 D3683V probably damaging Het
Galns T C 8: 122,585,026 D415G possibly damaging Het
Gatad2a G A 8: 69,916,420 T259M probably damaging Het
Gm13119 A T 4: 144,363,491 D367V probably damaging Het
Gm4951 A G 18: 60,246,070 I226V probably benign Het
Ifi209 T C 1: 173,638,976 S125P probably damaging Het
Il12rb2 G A 6: 67,292,262 R856W probably damaging Het
Kcnq3 A T 15: 65,997,773 Y605* probably null Het
Klk1b16 T C 7: 44,141,526 S251P probably benign Het
Map2 A G 1: 66,414,620 N890D probably damaging Het
Map4 T A 9: 110,034,678 S324T probably benign Het
Mmp28 T C 11: 83,442,858 D419G probably damaging Het
Mtnr1b A G 9: 15,862,914 L283P probably benign Het
Ndufb7 T A 8: 83,571,434 Y95N probably damaging Het
Nfrkb C T 9: 31,397,779 R280W probably damaging Het
Npc1l1 A G 11: 6,224,245 Y687H probably damaging Het
Olfr1099 T A 2: 86,958,580 R293* probably null Het
Olfr308 A C 7: 86,321,671 F94V possibly damaging Het
Olfr889 C T 9: 38,116,627 T277I probably benign Het
Olfr919 T C 9: 38,697,647 T240A probably damaging Het
Pabpc4l T C 3: 46,446,609 D200G probably benign Het
Plekhg6 T C 6: 125,372,551 E361G possibly damaging Het
Rictor A G 15: 6,789,565 Y1423C probably damaging Het
Rsf1 G A 7: 97,680,695 D1143N probably damaging Het
Spsb4 C T 9: 96,995,574 probably null Het
Strada G T 11: 106,171,017 A136E probably damaging Het
Syce2 A T 8: 84,883,502 Q73L probably damaging Het
Teddm2 A T 1: 153,850,384 V195D probably benign Het
Tex36 A T 7: 133,601,983 N12K probably benign Het
Ubtf A G 11: 102,308,959 S484P probably benign Het
Ufd1 T G 16: 18,817,930 L66R probably damaging Het
Vmn2r74 C T 7: 85,951,989 A814T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Xrcc1 T A 7: 24,567,928 probably null Het
Zfp277 A C 12: 40,335,309 C305G probably damaging Het
Other mutations in Gja8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Gja8 APN 3 96919242 missense probably benign
IGL02114:Gja8 APN 3 96920025 missense probably benign 0.00
IGL02237:Gja8 APN 3 96919933 missense probably benign 0.00
IGL03204:Gja8 APN 3 96920092 missense probably damaging 1.00
L1 UTSW 3 96920197 missense probably damaging 1.00
R1024:Gja8 UTSW 3 96919424 missense probably benign 0.00
R2215:Gja8 UTSW 3 96919902 missense probably damaging 0.98
R2240:Gja8 UTSW 3 96920302 missense probably benign 0.05
R2510:Gja8 UTSW 3 96919717 missense probably damaging 1.00
R2511:Gja8 UTSW 3 96919717 missense probably damaging 1.00
R2926:Gja8 UTSW 3 96919153 missense probably benign 0.00
R3725:Gja8 UTSW 3 96919845 missense probably damaging 1.00
R4090:Gja8 UTSW 3 96919152 missense probably benign 0.00
R4933:Gja8 UTSW 3 96919035 intron probably benign
R5010:Gja8 UTSW 3 96919849 missense probably benign 0.24
R5497:Gja8 UTSW 3 96920197 missense probably damaging 1.00
R6997:Gja8 UTSW 3 96919341 missense probably benign
R7381:Gja8 UTSW 3 96920022 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGGCCTCATCGTAGCAGAC -3'
(R):5'- ACACACTTTAAGAGCCCTTTCATC -3'

Sequencing Primer
(F):5'- GTAGCAGACATTCTCACAGCCTG -3'
(R):5'- CTCTTAGCACTAGTCGGCACAGATG -3'
Posted On2016-10-24