Incidental Mutation 'R5532:Adsl'
List |< first << previous [record 74 of 1871] next >> last >|
ID436244
Institutional Source Beutler Lab
Gene Symbol Adsl
Ensembl Gene ENSMUSG00000022407
Gene Nameadenylosuccinate lyase
Synonyms
MMRRC Submission 043090-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R5532 (G1)
Quality Score199
Status Not validated
Chromosome15
Chromosomal Location80948490-80970946 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 80963909 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 118 (P118A)
Ref Sequence ENSEMBL: ENSMUSP00000146546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023043] [ENSMUST00000164806] [ENSMUST00000166711] [ENSMUST00000168756] [ENSMUST00000169238] [ENSMUST00000200201] [ENSMUST00000207170]
Predicted Effect probably damaging
Transcript: ENSMUST00000023043
AA Change: P298A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023043
Gene: ENSMUSG00000022407
AA Change: P298A

DomainStartEndE-ValueType
Pfam:Lyase_1 49 313 4.4e-29 PFAM
ADSL_C 377 461 5.65e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163575
Predicted Effect probably damaging
Transcript: ENSMUST00000164806
AA Change: P298A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131998
Gene: ENSMUSG00000022407
AA Change: P298A

DomainStartEndE-ValueType
Pfam:Lyase_1 47 313 8.4e-29 PFAM
Blast:ADSL_C 377 416 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000166711
SMART Domains Protein: ENSMUSP00000129601
Gene: ENSMUSG00000022407

DomainStartEndE-ValueType
PDB:2VD6|D 1 134 3e-87 PDB
SCOP:d1c3ca_ 20 134 9e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168756
AA Change: P283A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127593
Gene: ENSMUSG00000022407
AA Change: P283A

DomainStartEndE-ValueType
Pfam:Lyase_1 115 298 3.9e-25 PFAM
ADSL_C 362 446 5.65e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169238
SMART Domains Protein: ENSMUSP00000132423
Gene: ENSMUSG00000022407

DomainStartEndE-ValueType
PDB:2VD6|D 1 134 3e-87 PDB
SCOP:d1c3ca_ 20 134 9e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199284
Predicted Effect probably benign
Transcript: ENSMUST00000200201
SMART Domains Protein: ENSMUSP00000143188
Gene: ENSMUSG00000022407

DomainStartEndE-ValueType
PDB:2VD6|D 1 119 6e-77 PDB
SCOP:d1c3ca_ 20 119 4e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207170
AA Change: P118A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in adenosine monophosphate (AMP) biosynthesis and maintaining AMP levels in the muscle. The encoded enzyme catalyzes the release of fumarate during AMP biosynthesis by cleaving the substrates succinylaminoimidazole carboxamide (SAICA) ribotide to give aminoimidazole carboxamide (AICA) ribotide, and adenylosuccinate to give adenylate. In humans, this gene is associated with adenylosuccinate deficiency, a rare autosomal disorder resulting in a spectrum of neurological symptoms. A pseudogene associated with this gene is located on the X chromosome. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
A2ml1 T A 6: 128,553,330 probably null Het
Ano6 C T 15: 95,962,241 P748L probably damaging Het
Arhgap10 A T 8: 77,420,072 N234K probably benign Het
Arhgap18 T A 10: 26,846,108 I25K possibly damaging Het
AW551984 T C 9: 39,597,185 Y345C probably damaging Het
Ccdc146 A G 5: 21,305,331 V561A probably benign Het
Cenpv G A 11: 62,527,572 T185M probably damaging Het
Fat2 T A 11: 55,262,337 D3683V probably damaging Het
Galns T C 8: 122,585,026 D415G possibly damaging Het
Gatad2a G A 8: 69,916,420 T259M probably damaging Het
Gja8 T C 3: 96,920,332 S5G probably benign Het
Gm13119 A T 4: 144,363,491 D367V probably damaging Het
Gm4951 A G 18: 60,246,070 I226V probably benign Het
Ifi209 T C 1: 173,638,976 S125P probably damaging Het
Il12rb2 G A 6: 67,292,262 R856W probably damaging Het
Kcnq3 A T 15: 65,997,773 Y605* probably null Het
Klk1b16 T C 7: 44,141,526 S251P probably benign Het
Map2 A G 1: 66,414,620 N890D probably damaging Het
Map4 T A 9: 110,034,678 S324T probably benign Het
Mmp28 T C 11: 83,442,858 D419G probably damaging Het
Mtnr1b A G 9: 15,862,914 L283P probably benign Het
Ndufb7 T A 8: 83,571,434 Y95N probably damaging Het
Nfrkb C T 9: 31,397,779 R280W probably damaging Het
Npc1l1 A G 11: 6,224,245 Y687H probably damaging Het
Olfr1099 T A 2: 86,958,580 R293* probably null Het
Olfr308 A C 7: 86,321,671 F94V possibly damaging Het
Olfr889 C T 9: 38,116,627 T277I probably benign Het
Olfr919 T C 9: 38,697,647 T240A probably damaging Het
Pabpc4l T C 3: 46,446,609 D200G probably benign Het
Plekhg6 T C 6: 125,372,551 E361G possibly damaging Het
Rictor A G 15: 6,789,565 Y1423C probably damaging Het
Rsf1 G A 7: 97,680,695 D1143N probably damaging Het
Spsb4 C T 9: 96,995,574 probably null Het
Strada G T 11: 106,171,017 A136E probably damaging Het
Syce2 A T 8: 84,883,502 Q73L probably damaging Het
Teddm2 A T 1: 153,850,384 V195D probably benign Het
Tex36 A T 7: 133,601,983 N12K probably benign Het
Ubtf A G 11: 102,308,959 S484P probably benign Het
Ufd1 T G 16: 18,817,930 L66R probably damaging Het
Vmn2r74 C T 7: 85,951,989 A814T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Xrcc1 T A 7: 24,567,928 probably null Het
Zfp277 A C 12: 40,335,309 C305G probably damaging Het
Other mutations in Adsl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Adsl APN 15 80948700 missense probably null 0.00
IGL02249:Adsl APN 15 80960475 missense probably benign 0.26
IGL03009:Adsl APN 15 80952243 nonsense probably null
R0046:Adsl UTSW 15 80962788 critical splice donor site probably null
R0046:Adsl UTSW 15 80962788 critical splice donor site probably null
R0194:Adsl UTSW 15 80961360 missense possibly damaging 0.91
R0575:Adsl UTSW 15 80963685 missense probably damaging 1.00
R1111:Adsl UTSW 15 80967660 missense probably damaging 1.00
R1606:Adsl UTSW 15 80952224 nonsense probably null
R1822:Adsl UTSW 15 80962742 nonsense probably null
R2152:Adsl UTSW 15 80967662 missense probably damaging 1.00
R2284:Adsl UTSW 15 80963895 missense probably damaging 0.99
R4008:Adsl UTSW 15 80966156 missense probably benign 0.05
R4010:Adsl UTSW 15 80966156 missense probably benign 0.05
R4011:Adsl UTSW 15 80966156 missense probably benign 0.05
R4202:Adsl UTSW 15 80952216 missense probably damaging 0.98
R4587:Adsl UTSW 15 80967767 critical splice donor site probably null
R5053:Adsl UTSW 15 80960450 missense probably damaging 1.00
R5086:Adsl UTSW 15 80963700 missense probably damaging 0.96
R5123:Adsl UTSW 15 80952294 unclassified probably null
R5187:Adsl UTSW 15 80948905 intron probably benign
R5416:Adsl UTSW 15 80952183 splice site probably null
R5898:Adsl UTSW 15 80961353 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAGATTGGTGAGTAGAGGCTCG -3'
(R):5'- CCAAGCTTCTTTGAGGGTAAGG -3'

Sequencing Primer
(F):5'- TCGGGAGCAGCATAACAC -3'
(R):5'- CTTCTTTGAGGGTAAGGAAGCAGAC -3'
Posted On2016-10-24