Incidental Mutation 'R5532:Vmn2r98'
ID436248
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Namevomeronasal 2, receptor 98
SynonymsEG224552
MMRRC Submission 043090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5532 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location19053460-19082411 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19067383 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 493 (S493P)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170424
AA Change: S493P

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: S493P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
A2ml1 T A 6: 128,553,330 probably null Het
Adsl C G 15: 80,963,909 P118A probably damaging Het
Ano6 C T 15: 95,962,241 P748L probably damaging Het
Arhgap10 A T 8: 77,420,072 N234K probably benign Het
Arhgap18 T A 10: 26,846,108 I25K possibly damaging Het
AW551984 T C 9: 39,597,185 Y345C probably damaging Het
Ccdc146 A G 5: 21,305,331 V561A probably benign Het
Cenpv G A 11: 62,527,572 T185M probably damaging Het
Fat2 T A 11: 55,262,337 D3683V probably damaging Het
Galns T C 8: 122,585,026 D415G possibly damaging Het
Gatad2a G A 8: 69,916,420 T259M probably damaging Het
Gja8 T C 3: 96,920,332 S5G probably benign Het
Gm13119 A T 4: 144,363,491 D367V probably damaging Het
Gm4951 A G 18: 60,246,070 I226V probably benign Het
Ifi209 T C 1: 173,638,976 S125P probably damaging Het
Il12rb2 G A 6: 67,292,262 R856W probably damaging Het
Kcnq3 A T 15: 65,997,773 Y605* probably null Het
Klk1b16 T C 7: 44,141,526 S251P probably benign Het
Map2 A G 1: 66,414,620 N890D probably damaging Het
Map4 T A 9: 110,034,678 S324T probably benign Het
Mmp28 T C 11: 83,442,858 D419G probably damaging Het
Mtnr1b A G 9: 15,862,914 L283P probably benign Het
Ndufb7 T A 8: 83,571,434 Y95N probably damaging Het
Nfrkb C T 9: 31,397,779 R280W probably damaging Het
Npc1l1 A G 11: 6,224,245 Y687H probably damaging Het
Olfr1099 T A 2: 86,958,580 R293* probably null Het
Olfr308 A C 7: 86,321,671 F94V possibly damaging Het
Olfr889 C T 9: 38,116,627 T277I probably benign Het
Olfr919 T C 9: 38,697,647 T240A probably damaging Het
Pabpc4l T C 3: 46,446,609 D200G probably benign Het
Plekhg6 T C 6: 125,372,551 E361G possibly damaging Het
Rictor A G 15: 6,789,565 Y1423C probably damaging Het
Rsf1 G A 7: 97,680,695 D1143N probably damaging Het
Spsb4 C T 9: 96,995,574 probably null Het
Strada G T 11: 106,171,017 A136E probably damaging Het
Syce2 A T 8: 84,883,502 Q73L probably damaging Het
Teddm2 A T 1: 153,850,384 V195D probably benign Het
Tex36 A T 7: 133,601,983 N12K probably benign Het
Ubtf A G 11: 102,308,959 S484P probably benign Het
Ufd1 T G 16: 18,817,930 L66R probably damaging Het
Vmn2r74 C T 7: 85,951,989 A814T probably benign Het
Xrcc1 T A 7: 24,567,928 probably null Het
Zfp277 A C 12: 40,335,309 C305G probably damaging Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19065745 splice site probably benign
IGL01296:Vmn2r98 APN 17 19065185 missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19065758 missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19065259 missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19066451 missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19066286 missense probably benign
IGL02123:Vmn2r98 APN 17 19080679 missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19065851 missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19065821 missense probably benign
IGL02650:Vmn2r98 APN 17 19080961 missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19065259 missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19066013 missense probably benign
IGL02807:Vmn2r98 APN 17 19081021 missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19065980 missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19069845 missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19080961 missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19066400 missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19065827 nonsense probably null
R0545:Vmn2r98 UTSW 17 19053613 missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19080497 missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19080520 missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19080749 missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19065948 missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19065178 missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19080908 missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19066440 missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19066418 missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19065333 nonsense probably null
R2165:Vmn2r98 UTSW 17 19081291 missense unknown
R2238:Vmn2r98 UTSW 17 19065951 missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19080436 missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19065819 missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19081177 missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19067402 missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19080625 missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19066092 missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19069745 missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19066340 missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19066157 missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19066044 missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19053553 missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19080719 missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19069754 nonsense probably null
R5371:Vmn2r98 UTSW 17 19069753 missense probably damaging 1.00
R5598:Vmn2r98 UTSW 17 19080899 missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19065998 missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19066074 missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19065881 missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19065801 missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19065248 missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19066268 missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19080922 missense probably benign
R7068:Vmn2r98 UTSW 17 19065313 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCTTAACTCGTTCCTGAAGG -3'
(R):5'- CCTCATATGAGAGAGCATTGTGAG -3'

Sequencing Primer
(F):5'- GCTTAACTCGTTCCTGAAGGATATTG -3'
(R):5'- GCATTGTGAGATTTATTGAACACTG -3'
Posted On2016-10-24