Incidental Mutation 'R0006:Rap1gds1'
ID43626
Institutional Source Beutler Lab
Gene Symbol Rap1gds1
Ensembl Gene ENSMUSG00000028149
Gene NameRAP1, GTP-GDP dissociation stimulator 1
SynonymsGDS1
MMRRC Submission 041980-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.708) question?
Stock #R0006 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138925902-139075201 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 138983871 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029796] [ENSMUST00000098574] [ENSMUST00000196106] [ENSMUST00000196280] [ENSMUST00000200396]
Predicted Effect probably benign
Transcript: ENSMUST00000029796
SMART Domains Protein: ENSMUSP00000029796
Gene: ENSMUSG00000028149

DomainStartEndE-ValueType
ARM 77 118 1.36e-6 SMART
ARM 119 162 7.98e-4 SMART
ARM 297 341 2.4e-7 SMART
ARM 342 382 6.3e1 SMART
ARM 430 470 6.39e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000098574
SMART Domains Protein: ENSMUSP00000096173
Gene: ENSMUSG00000028149

DomainStartEndE-ValueType
ARM 77 118 1.36e-6 SMART
ARM 169 211 1.74e-4 SMART
ARM 346 390 2.4e-7 SMART
ARM 391 431 6.3e1 SMART
ARM 479 519 6.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196106
Predicted Effect probably null
Transcript: ENSMUST00000196280
SMART Domains Protein: ENSMUSP00000143181
Gene: ENSMUSG00000028149

DomainStartEndE-ValueType
ARM 77 118 1.36e-6 SMART
ARM 169 211 1.74e-4 SMART
ARM 346 390 2.4e-7 SMART
ARM 391 431 6.3e1 SMART
ARM 478 518 6.39e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200262
Predicted Effect probably benign
Transcript: ENSMUST00000200396
SMART Domains Protein: ENSMUSP00000143517
Gene: ENSMUSG00000028149

DomainStartEndE-ValueType
ARM 77 118 6.7e-9 SMART
ARM 119 162 3.9e-6 SMART
ARM 297 341 1.2e-9 SMART
ARM 342 382 3.1e-1 SMART
ARM 430 470 3.1e-5 SMART
Meta Mutation Damage Score 0.6068 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The smg GDP dissociation stimulator (smgGDS) protein is a stimulatory GDP/GTP exchange protein with GTPase activity (Riess et al., 1993 [PubMed 8262526]).[supplied by OMIM, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,863,935 probably benign Het
Aldh3a1 G A 11: 61,217,101 V324M probably damaging Het
Als2cl T A 9: 110,894,618 L694Q possibly damaging Het
Appl2 A G 10: 83,602,898 F556L probably damaging Het
Atad2b T A 12: 4,942,030 S210T possibly damaging Het
Aurka A G 2: 172,359,753 probably null Het
Boc C T 16: 44,496,449 V444I probably benign Het
Ccdc109b A C 3: 129,933,765 probably benign Het
Cfap61 G A 2: 146,077,312 V655I probably benign Het
Chd8 A G 14: 52,235,293 I351T possibly damaging Het
Chid1 T A 7: 141,496,426 probably benign Het
Cyp3a41a T A 5: 145,704,796 H288L probably benign Het
Dnase2b T A 3: 146,582,489 I284F probably damaging Het
Dock2 A G 11: 34,312,453 probably benign Het
Dst C T 1: 34,228,918 T5325I probably benign Het
Erbb3 A G 10: 128,573,410 probably null Het
Fam129c A G 8: 71,605,044 probably benign Het
Fancl A G 11: 26,469,695 N316S possibly damaging Het
Farsa G T 8: 84,861,305 probably benign Het
Fibcd1 T G 2: 31,838,587 D86A probably damaging Het
Gab1 A T 8: 80,769,730 M617K possibly damaging Het
Gabrd C A 4: 155,388,601 V72L probably damaging Het
Ggh C A 4: 20,054,155 T150K possibly damaging Het
Gm340 A G 19: 41,584,899 T698A probably benign Het
Gnb3 G A 6: 124,835,804 probably benign Het
Hephl1 T A 9: 15,076,764 T683S probably benign Het
Hmcn1 G A 1: 150,808,676 P381L probably damaging Het
Hspa8 T G 9: 40,804,629 N544K probably benign Het
Hspg2 C T 4: 137,519,931 T1155I probably damaging Het
Igdcc4 C T 9: 65,135,100 probably benign Het
Jazf1 A G 6: 52,894,086 probably benign Het
Kntc1 T A 5: 123,789,138 S1219T probably benign Het
L3mbtl1 A T 2: 162,964,569 Y460F possibly damaging Het
Lyrm7 T A 11: 54,848,597 T76S probably benign Het
Map1b C T 13: 99,435,302 V304M probably damaging Het
Muc13 T C 16: 33,803,148 S271P probably damaging Het
Myo16 A G 8: 10,475,988 K843E probably damaging Het
Nav2 A G 7: 49,453,230 E531G possibly damaging Het
Nup188 T C 2: 30,322,023 V553A probably benign Het
Olfr1 A G 11: 73,395,488 F178S probably damaging Het
Olfr1348 A G 7: 6,501,611 I205T possibly damaging Het
Olfr376 A G 11: 73,375,588 M283V possibly damaging Het
Olfr646 A G 7: 104,106,320 I14V probably benign Het
Olfr877 T A 9: 37,855,220 V134D possibly damaging Het
P4ha3 C T 7: 100,318,948 R378* probably null Het
Rbfox1 T A 16: 7,330,420 S244R probably benign Het
Rpp40 G A 13: 35,896,735 P339S probably damaging Het
Rsph4a T C 10: 33,909,148 C148R probably damaging Het
Skint5 T C 4: 113,893,862 probably benign Het
Sptbn1 A G 11: 30,123,855 S1405P probably damaging Het
Tex35 T C 1: 157,099,744 K154E possibly damaging Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tle4 A G 19: 14,466,714 probably benign Het
Tnxb T C 17: 34,682,292 S1027P probably benign Het
Tpm3 T A 3: 90,087,661 probably benign Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Uggt2 A T 14: 119,049,663 F640L probably benign Het
Vmn1r20 T G 6: 57,432,305 H205Q probably damaging Het
Wbp2 T C 11: 116,079,788 probably null Het
Xirp1 T C 9: 120,017,454 I788V probably benign Het
Zc3hav1 A G 6: 38,319,702 probably null Het
Zfp687 A G 3: 95,011,456 I335T probably damaging Het
Zfpm1 A G 8: 122,334,488 Y264C probably damaging Het
Other mutations in Rap1gds1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Rap1gds1 APN 3 138983827 missense possibly damaging 0.95
IGL01314:Rap1gds1 APN 3 139050561 missense probably damaging 1.00
IGL01450:Rap1gds1 APN 3 138965920 missense probably damaging 1.00
IGL02033:Rap1gds1 APN 3 138955471 splice site probably benign
IGL02658:Rap1gds1 APN 3 138957479 missense probably damaging 1.00
IGL02745:Rap1gds1 APN 3 138956241 missense probably damaging 1.00
IGL02880:Rap1gds1 APN 3 138945756 missense probably benign 0.16
PIT4305001:Rap1gds1 UTSW 3 138956300 missense probably benign 0.05
R0006:Rap1gds1 UTSW 3 138983871 splice site probably null
R0585:Rap1gds1 UTSW 3 139021872 missense probably benign 0.16
R1573:Rap1gds1 UTSW 3 138965863 splice site probably null
R1793:Rap1gds1 UTSW 3 139050553 missense possibly damaging 0.94
R1960:Rap1gds1 UTSW 3 139050556 missense probably null 0.28
R2432:Rap1gds1 UTSW 3 138956250 missense probably damaging 0.99
R2697:Rap1gds1 UTSW 3 138983721 critical splice donor site probably null
R3792:Rap1gds1 UTSW 3 138965960 missense probably damaging 1.00
R4031:Rap1gds1 UTSW 3 139050592 splice site probably benign
R4194:Rap1gds1 UTSW 3 138959090 missense probably damaging 1.00
R4530:Rap1gds1 UTSW 3 138957425 missense probably damaging 1.00
R4696:Rap1gds1 UTSW 3 138927614 missense probably damaging 1.00
R4909:Rap1gds1 UTSW 3 138983748 missense possibly damaging 0.77
R5000:Rap1gds1 UTSW 3 138956250 missense probably damaging 1.00
R5046:Rap1gds1 UTSW 3 138955420 nonsense probably null
R5152:Rap1gds1 UTSW 3 138956201 missense probably damaging 1.00
R5163:Rap1gds1 UTSW 3 138959056 missense probably damaging 0.99
R5309:Rap1gds1 UTSW 3 138958628 missense probably damaging 1.00
R5312:Rap1gds1 UTSW 3 138958628 missense probably damaging 1.00
R5782:Rap1gds1 UTSW 3 138959079 missense possibly damaging 0.65
R5825:Rap1gds1 UTSW 3 138955375 missense possibly damaging 0.93
R6547:Rap1gds1 UTSW 3 138955338 missense probably damaging 1.00
R7227:Rap1gds1 UTSW 3 138957467 missense probably damaging 1.00
R7228:Rap1gds1 UTSW 3 138957467 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCAACCCTTAAAGCTGAGC -3'
(R):5'- CTCCAGTTTGCACAGCGAGGAT -3'

Sequencing Primer
(F):5'- GTGTAATTTCCCAACACCGTAAAG -3'
(R):5'- CTAAAAAGCAGTTGTCTCCTTACC -3'
Posted On2013-05-29