Incidental Mutation 'R5546:Polr1a'
ID436278
Institutional Source Beutler Lab
Gene Symbol Polr1a
Ensembl Gene ENSMUSG00000049553
Gene Namepolymerase (RNA) I polypeptide A
SynonymsRPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4
MMRRC Submission 043104-MU
Accession Numbers

Genbank: NM_009088; MGI: 1096397

Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R5546 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location71909053-71984935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71929366 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 389 (S389P)
Ref Sequence ENSEMBL: ENSMUSP00000060858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055296] [ENSMUST00000206556]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055296
AA Change: S389P

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: S389P

DomainStartEndE-ValueType
RPOLA_N 302 649 8.97e-137 SMART
Pfam:RNA_pol_Rpb1_4 846 958 1.3e-26 PFAM
Pfam:RNA_pol_Rpb1_5 965 1669 7e-103 PFAM
low complexity region 1698 1708 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205333
Predicted Effect probably benign
Transcript: ENSMUST00000206556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206823
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,929,633 N385S probably benign Het
Ahctf1 A T 1: 179,754,068 I1523N probably benign Het
Akna C T 4: 63,394,959 G309E probably benign Het
Akna T C 4: 63,395,566 N107D probably benign Het
Arhgef15 G A 11: 68,954,051 P240L probably benign Het
Brd1 T A 15: 88,701,122 E836D probably benign Het
Brf2 A G 8: 27,124,283 S292P possibly damaging Het
C3 A G 17: 57,222,976 L500P probably damaging Het
Ccdc107 T C 4: 43,495,685 L196P probably damaging Het
Cdcp1 G T 9: 123,178,029 P551Q probably damaging Het
Ckap5 T C 2: 91,594,816 L1224P probably damaging Het
Csnk1g2 C A 10: 80,638,398 T178K probably benign Het
Ctsq A T 13: 61,037,888 C146* probably null Het
Cyp2ab1 T A 16: 20,313,757 I264F probably damaging Het
Daxx TGATGATGACGATGATGACGATGATGA TGATGATGACGATGATGA 17: 33,912,641 probably benign Het
Dnah11 G A 12: 117,975,848 T3179M possibly damaging Het
Dnah7c A T 1: 46,666,317 T2497S probably damaging Het
Eif4enif1 T C 11: 3,243,989 V776A probably damaging Het
Erbb4 G T 1: 68,298,293 T622N probably damaging Het
Erich6 A G 3: 58,618,797 Y595H probably benign Het
Fam107a C T 14: 8,298,764 A121T probably benign Het
Gif T C 19: 11,748,495 S50P possibly damaging Het
Gpatch11 C T 17: 78,842,119 Q183* probably null Het
Gpr161 C A 1: 165,306,413 F81L possibly damaging Het
Hook1 G T 4: 96,002,528 E291D probably benign Het
Hsf2bp T A 17: 31,946,695 I309F probably damaging Het
Hspg2 T C 4: 137,548,174 probably null Het
Ide T G 19: 37,272,224 M910L unknown Het
Igdcc4 A G 9: 65,128,795 Y712C probably damaging Het
Kmt2d T C 15: 98,853,068 probably benign Het
Lats1 T C 10: 7,705,754 Y768H probably damaging Het
Mageb3 A G 2: 121,954,387 V278A probably damaging Het
Mapkbp1 G A 2: 120,019,243 R732H probably damaging Het
Marveld2 T C 13: 100,600,938 I148V probably benign Het
Mast1 G C 8: 84,916,260 P969A probably damaging Het
Myh10 T G 11: 68,798,380 V1261G possibly damaging Het
Nlrp1b A T 11: 71,217,276 H466Q probably benign Het
Npr2 T G 4: 43,650,150 V905G probably damaging Het
Oip5 T A 2: 119,610,327 I240F unknown Het
Olfr1259 A G 2: 89,943,585 C177R probably damaging Het
Olfr175-ps1 G T 16: 58,824,153 Y185* probably null Het
Olfr874 T A 9: 37,746,524 M130K probably benign Het
Pcsk2 G A 2: 143,546,560 A24T probably benign Het
Plxnb1 G T 9: 109,100,750 G225W probably damaging Het
Prkca A G 11: 108,053,980 V175A probably benign Het
Rassf7 C A 7: 141,217,060 probably null Het
Rbl2 A G 8: 91,078,932 I206V probably benign Het
Rnf111 A T 9: 70,459,096 H353Q probably benign Het
Rpn1 T G 6: 88,093,859 V237G probably damaging Het
Sec61a2 T A 2: 5,876,540 I267F possibly damaging Het
Spop G T 11: 95,485,843 V241F probably damaging Het
Sptbn2 C T 19: 4,725,950 A178V probably damaging Het
Stard13 A G 5: 151,045,901 Y791H probably benign Het
Susd2 T A 10: 75,642,218 I113L probably benign Het
Tcof1 T C 18: 60,831,556 E666G possibly damaging Het
Tekt5 G T 16: 10,361,390 A371E possibly damaging Het
Thap11 G A 8: 105,855,916 E186K probably damaging Het
Tk2 A T 8: 104,247,683 D45E possibly damaging Het
Tuba8 C A 6: 121,222,913 Y185* probably null Het
Usp24 T A 4: 106,416,047 Y2210N probably damaging Het
Wfdc8 A T 2: 164,597,319 probably benign Het
Zar1l T C 5: 150,512,900 N237S probably damaging Het
Zfp607b A T 7: 27,702,607 T163S probably benign Het
Zfp619 C A 7: 39,535,153 H202Q probably benign Het
Other mutations in Polr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Polr1a APN 6 71948486 missense probably benign 0.32
IGL01834:Polr1a APN 6 71948462 missense probably benign
IGL01902:Polr1a APN 6 71963748 missense probably damaging 1.00
IGL02101:Polr1a APN 6 71950802 missense probably benign 0.00
IGL02325:Polr1a APN 6 71920657 missense probably benign 0.38
IGL02398:Polr1a APN 6 71936556 splice site probably benign
IGL02528:Polr1a APN 6 71964717 missense probably benign
IGL02555:Polr1a APN 6 71920457 missense probably damaging 0.98
IGL02613:Polr1a APN 6 71967320 missense probably damaging 1.00
IGL02693:Polr1a APN 6 71963846 splice site probably benign
IGL02892:Polr1a APN 6 71931696 missense possibly damaging 0.70
IGL03059:Polr1a APN 6 71936512 missense probably benign
IGL03174:Polr1a APN 6 71977347 missense possibly damaging 0.82
D4043:Polr1a UTSW 6 71941417 missense possibly damaging 0.92
R0092:Polr1a UTSW 6 71967455 splice site probably benign
R0217:Polr1a UTSW 6 71963703 missense probably benign 0.19
R0267:Polr1a UTSW 6 71974139 missense probably damaging 0.99
R0329:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0330:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0352:Polr1a UTSW 6 71920763 splice site probably benign
R0411:Polr1a UTSW 6 71978421 missense possibly damaging 0.95
R0446:Polr1a UTSW 6 71950664 critical splice donor site probably null
R0846:Polr1a UTSW 6 71924643 missense probably damaging 1.00
R1035:Polr1a UTSW 6 71967916 missense probably benign
R1294:Polr1a UTSW 6 71912902 missense probably damaging 0.99
R1460:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R1657:Polr1a UTSW 6 71941535 missense probably damaging 1.00
R1846:Polr1a UTSW 6 71976188 missense probably damaging 0.98
R1862:Polr1a UTSW 6 71909203 missense probably damaging 0.96
R1865:Polr1a UTSW 6 71966524 missense probably damaging 1.00
R1903:Polr1a UTSW 6 71967914 missense probably benign 0.02
R1937:Polr1a UTSW 6 71936552 critical splice donor site probably null
R2063:Polr1a UTSW 6 71936285 splice site probably null
R2071:Polr1a UTSW 6 71976074 missense possibly damaging 0.64
R2084:Polr1a UTSW 6 71950809 missense possibly damaging 0.69
R2377:Polr1a UTSW 6 71972826 critical splice donor site probably null
R2410:Polr1a UTSW 6 71974882 missense probably benign
R3001:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3001:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3924:Polr1a UTSW 6 71929450 missense probably benign 0.00
R4105:Polr1a UTSW 6 71976191 missense probably damaging 0.98
R4125:Polr1a UTSW 6 71965706 missense probably benign 0.00
R4271:Polr1a UTSW 6 71953022 missense probably benign 0.02
R4440:Polr1a UTSW 6 71950848 missense probably damaging 0.98
R4667:Polr1a UTSW 6 71917821 missense probably benign 0.30
R4769:Polr1a UTSW 6 71950868 missense probably benign 0.01
R4801:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4802:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4828:Polr1a UTSW 6 71966401 missense possibly damaging 0.93
R4911:Polr1a UTSW 6 71909229 missense possibly damaging 0.67
R5071:Polr1a UTSW 6 71931709 missense possibly damaging 0.71
R5165:Polr1a UTSW 6 71967925 missense probably damaging 1.00
R5223:Polr1a UTSW 6 71967907 missense possibly damaging 0.73
R5239:Polr1a UTSW 6 71913037 missense probably damaging 1.00
R5599:Polr1a UTSW 6 71967362 missense possibly damaging 0.95
R5696:Polr1a UTSW 6 71929426 missense probably benign 0.05
R5850:Polr1a UTSW 6 71926683 missense probably benign 0.00
R6274:Polr1a UTSW 6 71954890 intron probably null
R6526:Polr1a UTSW 6 71929443 missense possibly damaging 0.89
R6578:Polr1a UTSW 6 71976041 missense possibly damaging 0.93
R6660:Polr1a UTSW 6 71967374 missense probably damaging 0.98
R6892:Polr1a UTSW 6 71964712 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TACCATCTGTCAGCTTCCAGGG -3'
(R):5'- TGTTAGCTGCTGACCCTCAC -3'

Sequencing Primer
(F):5'- AGGGCATTGGATCCCATTAC -3'
(R):5'- TCACCAACATGTGATCGGAATC -3'
Posted On2016-10-24